EMAIL THIS PAGE TO A FRIEND

FOXD4L2

forkhead box D4-like 2

13 Gene Product Result for
Species: Human FOXD4L2(100036519)
UniProtKB ID: Q6VB85
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301064 ANTI-FOXD4L2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099279 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320357 predicted 2438
2 SASI_Hs02_00320358 predicted 2308
3 SASI_Hs02_00320359 predicted 2548
4 SASI_Hs02_00320360 predicted 2473
5 SASI_Hs02_00320361 predicted 2499
6 SASI_Hs02_00320362 predicted 2490
7 SASI_Hs02_00320363 predicted 2306
8 SASI_Hs02_00320364 predicted 2548
9 SASI_Hs02_00320365 predicted 2515
10 SASI_Hs02_00320366 predicted 2352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099279
FOXD4L2 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1071s21c1
Sequence:CCGGCGAGTGACCCTTCAGAGTTTGCTCGAGCAAACTCTGAAGGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1803s21c1
Sequence:CCGGTTTCAGCATTGAGAGTATTATCTCGAGATAATACTCTCAATGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1395s21c1
Sequence:CCGGCCCAGGACATGTTCGACAATGCTCGAGCATTGTCGAACATGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099279.1-2786s21c1
Sequence:CCGGAGGTACACAAAGGGCAAATTACTCGAGTAATTTGCCCTTTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1164s21c1
Sequence:CCGGACTCGTACATCGCGCTCATCACTCGAGTGATGAGCGCGATGTACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099279
FOXD4L2 MISSION shRNA shRNA Plasmid DNA
forkhead box D4-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1071s21c1
Sequence:CCGGCGAGTGACCCTTCAGAGTTTGCTCGAGCAAACTCTGAAGGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1803s21c1
Sequence:CCGGTTTCAGCATTGAGAGTATTATCTCGAGATAATACTCTCAATGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1395s21c1
Sequence:CCGGCCCAGGACATGTTCGACAATGCTCGAGCATTGTCGAACATGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099279.1-2786s21c1
Sequence:CCGGAGGTACACAAAGGGCAAATTACTCGAGTAATTTGCCCTTTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1164s21c1
Sequence:CCGGACTCGTACATCGCGCTCATCACTCGAGTGATGAGCGCGATGTACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099279
FOXD4L2 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1071s21c1
Sequence:CCGGCGAGTGACCCTTCAGAGTTTGCTCGAGCAAACTCTGAAGGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1803s21c1
Sequence:CCGGTTTCAGCATTGAGAGTATTATCTCGAGATAATACTCTCAATGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1395s21c1
Sequence:CCGGCCCAGGACATGTTCGACAATGCTCGAGCATTGTCGAACATGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099279.1-2786s21c1
Sequence:CCGGAGGTACACAAAGGGCAAATTACTCGAGTAATTTGCCCTTTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099279.1-1164s21c1
Sequence:CCGGACTCGTACATCGCGCTCATCACTCGAGTGATGAGCGCGATGTACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks