EMAIL THIS PAGE TO A FRIEND

FOXD4L3

forkhead box D4-like 3

23 Gene Product Result for
Synonyms: FOXD4L2 FOXD6
Species: Human FOXD4L3(286380)
UniProtKB ID: Q6VB84, Q5JTX9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301985 ANTI-FOXD4L3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199135 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147681 MISSION® esiRNA esiRNA human FOXD4L3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199135 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372568 predicted 1602
2 SASI_Hs02_00372569 predicted 686
3 SASI_Hs02_00372570 predicted 1680
4 SASI_Hs02_00372571 predicted 454
5 SASI_Hs01_00187428 predicted 1061
6 SASI_Hs02_00372572 predicted 1819
7 SASI_Hs02_00372573 predicted 1520
8 SASI_Hs02_00372574 predicted 1463
9 SASI_Hs02_00372575 predicted 1354
10 SASI_Hs02_00372576 predicted 1049
11 SASI_Hs01_00187426 predicted 1041
12 SASI_Hs01_00187427 predicted 1044
13 SASI_Hs01_00187429 predicted 1701
14 SASI_Hs01_00187430 predicted 1032
15 SASI_Hs01_00187431 predicted 1063
16 SASI_Hs01_00187432 predicted 863
17 SASI_Hs01_00187433 predicted 876
18 SASI_Hs01_00187434 predicted 979
19 SASI_Hs01_00187435 predicted 1213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199135
FOXD4L3 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199135.1-1997s1c1
Sequence:CCGGGCCTAGTTATATAGACGAAATCTCGAGATTTCGTCTATATAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-1156s1c1
Sequence:CCGGCGACCATCAAGCCTGTTGCATCTCGAGATGCAACAGGCTTGATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-655s1c1
Sequence:CCGGCATGTTCGACAATGGCAGCTTCTCGAGAAGCTGCCATTGTCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-415s1c1
Sequence:CCGGCTACTCGTACATCGCGCTCATCTCGAGATGAGCGCGATGTACGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-647s1c1
Sequence:CCGGTCCCAAGACATGTTCGACAATCTCGAGATTGTCGAACATGTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199135
FOXD4L3 MISSION shRNA shRNA Plasmid DNA
forkhead box D4-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199135.1-1997s1c1
Sequence:CCGGGCCTAGTTATATAGACGAAATCTCGAGATTTCGTCTATATAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-1156s1c1
Sequence:CCGGCGACCATCAAGCCTGTTGCATCTCGAGATGCAACAGGCTTGATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-655s1c1
Sequence:CCGGCATGTTCGACAATGGCAGCTTCTCGAGAAGCTGCCATTGTCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-415s1c1
Sequence:CCGGCTACTCGTACATCGCGCTCATCTCGAGATGAGCGCGATGTACGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-647s1c1
Sequence:CCGGTCCCAAGACATGTTCGACAATCTCGAGATTGTCGAACATGTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199135
FOXD4L3 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199135.1-1997s1c1
Sequence:CCGGGCCTAGTTATATAGACGAAATCTCGAGATTTCGTCTATATAACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-1156s1c1
Sequence:CCGGCGACCATCAAGCCTGTTGCATCTCGAGATGCAACAGGCTTGATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-655s1c1
Sequence:CCGGCATGTTCGACAATGGCAGCTTCTCGAGAAGCTGCCATTGTCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-415s1c1
Sequence:CCGGCTACTCGTACATCGCGCTCATCTCGAGATGAGCGCGATGTACGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199135.1-647s1c1
Sequence:CCGGTCCCAAGACATGTTCGACAATCTCGAGATTGTCGAACATGTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks