EMAIL THIS PAGE TO A FRIEND

FOXD4L4

forkhead box D4-like 4

69 Gene Product Result for
Synonyms: FOXD4b bA460E7.2
Species: Human FOXD4L4(349334)
UniProtKB ID: Q8WXT5, Q5RIB4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199244 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199244 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220326 predicted 2442
2 SASI_Hs01_00220327 predicted 2307
3 SASI_Hs01_00220328 predicted 2545
4 SASI_Hs01_00220329 predicted 2464
5 SASI_Hs01_00220330 predicted 2493
6 SASI_Hs01_00220333 predicted 2489
7 SASI_Hs01_00220334 predicted 2304
8 SASI_Hs01_00220335 predicted 2545
9 SASI_Hs02_00372680 predicted 2523
10 SASI_Hs02_00372681 predicted 2353
11 SASI_Hs01_00220331 predicted 2460
12 SASI_Hs01_00220332 predicted 2496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199244
FOXD4L4 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4-like 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-959s1c1
Sequence:CCGGCGGATGCTTCTCTTTCAGCATCTCGAGATGCTGAAAGAGAAGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-483s1c1
Sequence:CCGGGCTGAACGACTGCTTCGTTAACTCGAGTTAACGAAGCAGTCGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-246s1c1
Sequence:CCGGCCCTTCAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-1067s1c1
Sequence:CCGGCCAGCGACCATCAAGCCTGTTCTCGAGAACAGGCTTGATGGTCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-970s1c1
Sequence:CCGGCTTTCAGCATTGAGAGTATTACTCGAGTAATACTCTCAATGCTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199244.2-2477s21c1
Sequence:CCGGCTTTGAAGATTAGTGACATAGCTCGAGCTATGTCACTAATCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199244.2-1628s21c1
Sequence:CCGGCATCCTCTTCGCTACCTACTGCTCGAGCAGTAGGTAGCGAAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199244
FOXD4L4 MISSION shRNA shRNA Plasmid DNA
forkhead box D4-like 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-959s1c1
Sequence:CCGGCGGATGCTTCTCTTTCAGCATCTCGAGATGCTGAAAGAGAAGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-483s1c1
Sequence:CCGGGCTGAACGACTGCTTCGTTAACTCGAGTTAACGAAGCAGTCGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-246s1c1
Sequence:CCGGCCCTTCAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-1067s1c1
Sequence:CCGGCCAGCGACCATCAAGCCTGTTCTCGAGAACAGGCTTGATGGTCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-970s1c1
Sequence:CCGGCTTTCAGCATTGAGAGTATTACTCGAGTAATACTCTCAATGCTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199244.2-2477s21c1
Sequence:CCGGCTTTGAAGATTAGTGACATAGCTCGAGCTATGTCACTAATCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199244.2-1628s21c1
Sequence:CCGGCATCCTCTTCGCTACCTACTGCTCGAGCAGTAGGTAGCGAAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199244
FOXD4L4 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4-like 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-959s1c1
Sequence:CCGGCGGATGCTTCTCTTTCAGCATCTCGAGATGCTGAAAGAGAAGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-483s1c1
Sequence:CCGGGCTGAACGACTGCTTCGTTAACTCGAGTTAACGAAGCAGTCGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-246s1c1
Sequence:CCGGCCCTTCAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-1067s1c1
Sequence:CCGGCCAGCGACCATCAAGCCTGTTCTCGAGAACAGGCTTGATGGTCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199244.1-970s1c1
Sequence:CCGGCTTTCAGCATTGAGAGTATTACTCGAGTAATACTCTCAATGCTGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199244.2-2477s21c1
Sequence:CCGGCTTTGAAGATTAGTGACATAGCTCGAGCTATGTCACTAATCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199244.2-1628s21c1
Sequence:CCGGCATCCTCTTCGCTACCTACTGCTCGAGCAGTAGGTAGCGAAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks