EMAIL THIS PAGE TO A FRIEND

FOXD4L5

forkhead box D4-like 5

13 Gene Product Result for
Synonyms: bA15J10.2
Species: Human FOXD4L5(653427)
UniProtKB ID: Q5VV16
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301807 ANTI-FOXD4L5 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001126334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126334 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328437 predicted 2436
2 SASI_Hs02_00328438 predicted 2311
3 SASI_Hs02_00328439 predicted 2545
4 SASI_Hs02_00328440 predicted 2468
5 SASI_Hs02_00328441 predicted 2455
6 SASI_Hs02_00328442 predicted 2496
7 SASI_Hs02_00328443 predicted 2495
8 SASI_Hs02_00328444 predicted 2468
9 SASI_Hs02_00328445 predicted 2304
10 SASI_Hs02_00328446 predicted 2548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126334
FOXD4L5 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4-like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1163s21c1
Sequence:CCGGTACTCGTACATCGCGCTCATCCTCGAGGATGAGCGCGATGTACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126334.1-2787s21c1
Sequence:CCGGGGTACACAAAGGGCAAATTATCTCGAGATAATTTGCCCTTTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1246s21c1
Sequence:CCGGTAGTGGCCGCTTCCCATACTACTCGAGTAGTATGGGAAGCGGCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1804s21c1
Sequence:CCGGTTCAGCATTGAGAGTATTATGCTCGAGCATAATACTCTCAATGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1961s21c1
Sequence:CCGGCCGCTGCTGCTCGGACAATTTCTCGAGAAATTGTCCGAGCAGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126334
FOXD4L5 MISSION shRNA shRNA Plasmid DNA
forkhead box D4-like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1163s21c1
Sequence:CCGGTACTCGTACATCGCGCTCATCCTCGAGGATGAGCGCGATGTACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126334.1-2787s21c1
Sequence:CCGGGGTACACAAAGGGCAAATTATCTCGAGATAATTTGCCCTTTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1246s21c1
Sequence:CCGGTAGTGGCCGCTTCCCATACTACTCGAGTAGTATGGGAAGCGGCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1804s21c1
Sequence:CCGGTTCAGCATTGAGAGTATTATGCTCGAGCATAATACTCTCAATGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1961s21c1
Sequence:CCGGCCGCTGCTGCTCGGACAATTTCTCGAGAAATTGTCCGAGCAGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126334
FOXD4L5 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4-like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1163s21c1
Sequence:CCGGTACTCGTACATCGCGCTCATCCTCGAGGATGAGCGCGATGTACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126334.1-2787s21c1
Sequence:CCGGGGTACACAAAGGGCAAATTATCTCGAGATAATTTGCCCTTTGTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1246s21c1
Sequence:CCGGTAGTGGCCGCTTCCCATACTACTCGAGTAGTATGGGAAGCGGCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1804s21c1
Sequence:CCGGTTCAGCATTGAGAGTATTATGCTCGAGCATAATACTCTCAATGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126334.1-1961s21c1
Sequence:CCGGCCGCTGCTGCTCGGACAATTTCTCGAGAAATTGTCCGAGCAGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks