EMAIL THIS PAGE TO A FRIEND

FOXD4L6

forkhead box D4-like 6

26 Gene Product Result for
Species: Human FOXD4L6(653404)
UniProtKB ID: Q3SYB3, B2RPC4, Q4V336
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500008 Anti-FOXD4 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085476 Rosetta Predictions human pricing
XM_928867 Rosetta Predictions human pricing
XM_933246 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317935 predicted 2107
2 SASI_Hs02_00317936 predicted 1189
3 SASI_Hs02_00317937 predicted 2186
4 SASI_Hs02_00317938 predicted 2029
5 SASI_Hs02_00317939 predicted 956
6 SASI_Hs02_00317940 predicted 1560
7 SASI_Hs02_00317941 predicted 2329
8 SASI_Hs02_00317942 predicted 1967
9 SASI_Hs02_00317943 predicted 1859
10 SASI_Hs02_00317944 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255540 predicted 1830
2 SASI_Hs01_00255541 predicted 915
3 SASI_Hs01_00255542 predicted 1910
4 SASI_Hs01_00255543 predicted 1750
5 SASI_Hs01_00255544 predicted 685
6 SASI_Hs01_00255545 predicted 1284
7 SASI_Hs01_00255546 predicted 2048
8 SASI_Hs01_00255547 predicted 1688
9 SASI_Hs01_00255548 predicted 1587
10 SASI_Hs01_00255549 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298120 predicted 2761
2 SASI_Hs01_00298121 predicted 2603
3 SASI_Hs01_00298122 predicted 2601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085476
FOXD4L6 MISSION shRNA Bacterial Glycerol Stock
forkhead box D4-like 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1387s21c1
Sequence:CCGGGCATCCTCTTCGCTACCTACTCTCGAGAGTAGGTAGCGAAGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1155s21c1
Sequence:CCGGCCCAAGACATGTTCGACAATGCTCGAGCATTGTCGAACATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085476.1-2538s21c1
Sequence:CCGGACTACACTACATCGTTTATTTCTCGAGAAATAAACGATGTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1201s21c1
Sequence:CCGGTTTCAAGCGCCACCAACTGACCTCGAGGTCAGTTGGTGGCGCTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1553s21c1
Sequence:CCGGGATGCATCTCTTTCAGCATTGCTCGAGCAATGCTGAAAGAGATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085476
FOXD4L6 MISSION shRNA shRNA Plasmid DNA
forkhead box D4-like 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1387s21c1
Sequence:CCGGGCATCCTCTTCGCTACCTACTCTCGAGAGTAGGTAGCGAAGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1155s21c1
Sequence:CCGGCCCAAGACATGTTCGACAATGCTCGAGCATTGTCGAACATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085476.1-2538s21c1
Sequence:CCGGACTACACTACATCGTTTATTTCTCGAGAAATAAACGATGTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1201s21c1
Sequence:CCGGTTTCAAGCGCCACCAACTGACCTCGAGGTCAGTTGGTGGCGCTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1553s21c1
Sequence:CCGGGATGCATCTCTTTCAGCATTGCTCGAGCAATGCTGAAAGAGATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085476
FOXD4L6 MISSION shRNA Lentiviral Transduction Particles
forkhead box D4-like 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1387s21c1
Sequence:CCGGGCATCCTCTTCGCTACCTACTCTCGAGAGTAGGTAGCGAAGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1155s21c1
Sequence:CCGGCCCAAGACATGTTCGACAATGCTCGAGCATTGTCGAACATGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085476.1-2538s21c1
Sequence:CCGGACTACACTACATCGTTTATTTCTCGAGAAATAAACGATGTAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1201s21c1
Sequence:CCGGTTTCAAGCGCCACCAACTGACCTCGAGGTCAGTTGGTGGCGCTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085476.1-1553s21c1
Sequence:CCGGGATGCATCTCTTTCAGCATTGCTCGAGCAATGCTGAAAGAGATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks