EMAIL THIS PAGE TO A FRIEND

FOXE1

forkhead box E1 (thyroid transcription factor 2)

73 Gene Product Result for
Synonyms: FKHL15 FOXE2 HFKH4 HFKL5 TITF2 TTF-2 TTF2
UniProtKB ID: O00358, O75765, Q5T109, Q99526
Gene ID:
Human(2304) Summary: This intronless gene belongs to the forkhead family of transcription factors, which is characterized by a distinct forkhead domain. This gene functions as a thyroid transcription factor which likely plays a crucial role in thyroid morphogenesis. Mutations in this gene are associated with congenital hypothyroidism and cleft palate with thyroid dysgenesis. The map localization of this gene suggests it may also be a candidate gene for squamous cell epithelioma and hereditary sensory neuropathy type I. [provided by RefSeq, Jul 2008]
Mouse(110805) forkhead box E1
Rat(192274) forkhead box E1 (thyroid transcription factor 2)
Zebrafish(567676) forkhead box E1 (thyroid transcription factor 2)
chicken(768789) forkhead box E1 (thyroid transcription factor 2)
cow(616734) forkhead box E1 (thyroid transcription factor 2)
dog(100683977) forkhead box E1 (thyroid transcription factor 2)
sheep(101104562) forkhead box E1 (thyroid transcription factor 2)
domestic guinea pig(101788559) forkhead box E1 (thyroid transcription factor 2)
naked mole-rat(101726116) forkhead box E1 (thyroid transcription factor 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004473 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004473 Rosetta Predictions human pricing
NM_138909 Rosetta Predictions rat pricing
NM_183298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191046 predicted 2093
2 SASI_Hs01_00191047 predicted 1843
3 SASI_Hs01_00191048 predicted 1825
4 SASI_Hs01_00191049 predicted 1738
5 SASI_Hs01_00191050 predicted 2065
6 SASI_Hs01_00191051 predicted 2030
7 SASI_Hs01_00191052 predicted 2172
8 SASI_Hs01_00191053 predicted 1805
9 SASI_Hs01_00191054 predicted 1748
10 SASI_Hs01_00191055 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268388 predicted 1386
2 SASI_Rn01_00114074 predicted 1733
3 SASI_Rn01_00114076 predicted 768
4 SASI_Rn01_00114077 predicted 805
5 SASI_Rn01_00114078 predicted 1733
6 SASI_Rn01_00114079 predicted 2040
7 SASI_Rn01_00114080 predicted 2010
8 SASI_Rn01_00114081 predicted 1839
9 SASI_Rn01_00114082 predicted 1844
10 SASI_Rn01_00114083 predicted 771
11 SASI_Rn01_00114075 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151668 predicted 392
2 SASI_Mm01_00151669 predicted 402
3 SASI_Mm01_00151670 predicted 362
4 SASI_Mm01_00151671 predicted 470
5 SASI_Mm01_00151672 predicted 355
6 SASI_Mm01_00151673 predicted 400
7 SASI_Mm01_00151674 predicted 469
8 SASI_Mm01_00151675 predicted 360
9 SASI_Mm01_00151676 predicted 408
10 SASI_Mm01_00151677 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004473
FOXE1 MISSION shRNA Bacterial Glycerol Stock
forkhead box E1 (thyroid transcription factor 2)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004473.3-2031s21c1
Sequence:CCGGACGGGATGCTTTCTGGTATTCCTCGAGGAATACCAGAAAGCATCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004473.3-2197s21c1
Sequence:CCGGTAACTGCGTTACTACAATAAACTCGAGTTTATTGTAGTAACGCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004473.3-1540s21c1
Sequence:CCGGAGTGCGATCTTTGCCGCTGCTCTCGAGAGCAGCGGCAAAGATCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-894s1c1
Sequence:CCGGCATCTACAAGTTCATCACCGACTCGAGTCGGTGATGAACTTGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1738s1c1
Sequence:CCGGGCCGCTTATCCCGGTGGGATACTCGAGTATCCCACCGGGATAAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1119s1c1
Sequence:CCGGCCTCTCCACCTACCCGGCTTACTCGAGTAAGCCGGGTAGGTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004473.3-2700s1c1
Sequence:CCGGGCCCAGTCATAAATCTGCTTTCTCGAGAAAGCAGATTTATGACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1611s1c1
Sequence:CCGGCGTGGAGACCACGGTGGACTTCTCGAGAAGTCCACCGTGGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004473
FOXE1 MISSION shRNA shRNA Plasmid DNA
forkhead box E1 (thyroid transcription factor 2)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004473.3-2031s21c1
Sequence:CCGGACGGGATGCTTTCTGGTATTCCTCGAGGAATACCAGAAAGCATCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004473.3-2197s21c1
Sequence:CCGGTAACTGCGTTACTACAATAAACTCGAGTTTATTGTAGTAACGCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004473.3-1540s21c1
Sequence:CCGGAGTGCGATCTTTGCCGCTGCTCTCGAGAGCAGCGGCAAAGATCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-894s1c1
Sequence:CCGGCATCTACAAGTTCATCACCGACTCGAGTCGGTGATGAACTTGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1738s1c1
Sequence:CCGGGCCGCTTATCCCGGTGGGATACTCGAGTATCCCACCGGGATAAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1119s1c1
Sequence:CCGGCCTCTCCACCTACCCGGCTTACTCGAGTAAGCCGGGTAGGTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004473.3-2700s1c1
Sequence:CCGGGCCCAGTCATAAATCTGCTTTCTCGAGAAAGCAGATTTATGACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1611s1c1
Sequence:CCGGCGTGGAGACCACGGTGGACTTCTCGAGAAGTCCACCGTGGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004473
FOXE1 MISSION shRNA Lentiviral Transduction Particles
forkhead box E1 (thyroid transcription factor 2)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004473.3-2031s21c1
Sequence:CCGGACGGGATGCTTTCTGGTATTCCTCGAGGAATACCAGAAAGCATCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004473.3-2197s21c1
Sequence:CCGGTAACTGCGTTACTACAATAAACTCGAGTTTATTGTAGTAACGCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004473.3-1540s21c1
Sequence:CCGGAGTGCGATCTTTGCCGCTGCTCTCGAGAGCAGCGGCAAAGATCGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-894s1c1
Sequence:CCGGCATCTACAAGTTCATCACCGACTCGAGTCGGTGATGAACTTGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1738s1c1
Sequence:CCGGGCCGCTTATCCCGGTGGGATACTCGAGTATCCCACCGGGATAAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1119s1c1
Sequence:CCGGCCTCTCCACCTACCCGGCTTACTCGAGTAAGCCGGGTAGGTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004473.3-2700s1c1
Sequence:CCGGGCCCAGTCATAAATCTGCTTTCTCGAGAAAGCAGATTTATGACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004473.3-1611s1c1
Sequence:CCGGCGTGGAGACCACGGTGGACTTCTCGAGAAGTCCACCGTGGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183298
FOXE1 MISSION shRNA Bacterial Glycerol Stock
forkhead box E1 (thyroid transcription factor 2)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-178s21c1
Sequence:CCGGTACATCGCGCTCATCGCTATGCTCGAGCATAGCGATGAGCGCGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-401s21c1
Sequence:CCGGACGCCGAGGACATGTTCGAAACTCGAGTTTCGAACATGTCCTCGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-314s21c1
Sequence:CCGGACAACCTCACCCTCAACGACTCTCGAGAGTCGTTGAGGGTGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-264s1c1
Sequence:CCGGCTTCCCGTTCTACCGCGACAACTCGAGTTGTCGCGGTAGAACGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-649s1c1
Sequence:CCGGTGCCGGGTCTTCGGCTTGGTTCTCGAGAACCAAGCCGAAGACCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-942s1c1
Sequence:CCGGCGTGGAGGCCACGGTGGACTTCTCGAGAAGTCCACCGTGGCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-858s1c1
Sequence:CCGGAGGAGCGAGCAGTGCGCTCTTCTCGAGAAGAGCGCACTGCTCGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183298
FOXE1 MISSION shRNA shRNA Plasmid DNA
forkhead box E1 (thyroid transcription factor 2)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-178s21c1
Sequence:CCGGTACATCGCGCTCATCGCTATGCTCGAGCATAGCGATGAGCGCGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-401s21c1
Sequence:CCGGACGCCGAGGACATGTTCGAAACTCGAGTTTCGAACATGTCCTCGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-314s21c1
Sequence:CCGGACAACCTCACCCTCAACGACTCTCGAGAGTCGTTGAGGGTGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-264s1c1
Sequence:CCGGCTTCCCGTTCTACCGCGACAACTCGAGTTGTCGCGGTAGAACGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-649s1c1
Sequence:CCGGTGCCGGGTCTTCGGCTTGGTTCTCGAGAACCAAGCCGAAGACCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-942s1c1
Sequence:CCGGCGTGGAGGCCACGGTGGACTTCTCGAGAAGTCCACCGTGGCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-858s1c1
Sequence:CCGGAGGAGCGAGCAGTGCGCTCTTCTCGAGAAGAGCGCACTGCTCGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183298
FOXE1 MISSION shRNA Lentiviral Transduction Particles
forkhead box E1 (thyroid transcription factor 2)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-178s21c1
Sequence:CCGGTACATCGCGCTCATCGCTATGCTCGAGCATAGCGATGAGCGCGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-401s21c1
Sequence:CCGGACGCCGAGGACATGTTCGAAACTCGAGTTTCGAACATGTCCTCGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183298.1-314s21c1
Sequence:CCGGACAACCTCACCCTCAACGACTCTCGAGAGTCGTTGAGGGTGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-264s1c1
Sequence:CCGGCTTCCCGTTCTACCGCGACAACTCGAGTTGTCGCGGTAGAACGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-649s1c1
Sequence:CCGGTGCCGGGTCTTCGGCTTGGTTCTCGAGAACCAAGCCGAAGACCCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-942s1c1
Sequence:CCGGCGTGGAGGCCACGGTGGACTTCTCGAGAAGTCCACCGTGGCCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183298.1-858s1c1
Sequence:CCGGAGGAGCGAGCAGTGCGCTCTTCTCGAGAAGAGCGCACTGCTCGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks