EMAIL THIS PAGE TO A FRIEND

FOXE3

forkhead box E3

52 Gene Product Result for
Synonyms: FKHL12 FREAC8
UniProtKB ID: Q13461, Q5SVY9, Q9NQV9
Gene ID:
Human(2301) Summary: This intronless gene belongs to the forkhead family of transcription factors, which is characterized by a distinct forkhead domain. The protein encoded functions as a lens-specific transcription factor and plays an important role in vertebrate lens formation. Mutations in this gene are associated with anterior segment mesenchymal dysgenesis and congenital primary aphakia. [provided by RefSeq, Dec 2009]
Mouse(30923) forkhead box E3
Rat(171302) forkhead box E3
naked mole-rat(101703365) forkhead box E3
Zebrafish(570855) forkhead box E3
cow(787258) forkhead box E3
dog(610277) forkhead box E3
chicken(772006) forkhead box E3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32304 Anti-FOXE3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4500927 Anti-FOXE3 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB2104071 Anti-FOXE3, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012186 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012186 Rosetta Predictions human pricing
XM_001069443 Rosetta Predictions rat pricing
XM_233428 Rosetta Predictions rat pricing
NM_015758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083366 predicted 1330
2 SASI_Hs01_00083367 predicted 1409
3 SASI_Hs01_00083368 predicted 1567
4 SASI_Hs01_00083369 predicted 1539
5 SASI_Hs01_00083370 predicted 1554
6 SASI_Hs01_00083371 predicted 1568
7 SASI_Hs01_00083372 predicted 1676
8 SASI_Hs01_00083373 predicted 1329
9 SASI_Hs01_00083374 predicted 1558
10 SASI_Hs02_00343811 predicted 1667
11 SASI_Hs01_00083365 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328094 predicted 309
2 SASI_Rn02_00328095 predicted 243
3 SASI_Rn02_00328096 predicted 258
4 SASI_Rn02_00328097 predicted 280
5 SASI_Rn02_00328098 predicted 230
6 SASI_Rn02_00328099 predicted 279
7 SASI_Rn02_00328100 predicted 302
8 SASI_Rn02_00328101 predicted 421
9 SASI_Rn02_00328102 predicted 234
10 SASI_Rn02_00328103 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129030 predicted 303
2 SASI_Rn01_00129031 predicted 241
3 SASI_Rn01_00129032 predicted 255
4 SASI_Rn01_00129033 predicted 280
5 SASI_Rn01_00129034 predicted 228
6 SASI_Rn01_00129035 predicted 277
7 SASI_Rn01_00129036 predicted 302
8 SASI_Rn01_00129037 predicted 418
9 SASI_Rn01_00129038 predicted 237
10 SASI_Rn01_00129039 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140978 predicted 207
2 SASI_Mm01_00140979 predicted 243
3 SASI_Mm01_00140980 predicted 258
4 SASI_Mm01_00140981 predicted 233
5 SASI_Mm01_00140982 predicted 234
6 SASI_Mm01_00140983 predicted 258
7 SASI_Mm01_00140984 predicted 261
8 SASI_Mm01_00140985 predicted 253
9 SASI_Mm01_00140986 predicted 255
10 SASI_Mm01_00140987 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015758
FOXE3 MISSION shRNA Bacterial Glycerol Stock
forkhead box E3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-171s1c1
Sequence:CCGGGCGGCCACTACAGCGTGGGAACTCGAGTTCCCACGCTGTAGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-351s1c1
Sequence:CCGGCCTCAACGACTGTTTCGTCAACTCGAGTTGACGAAACAGTCGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-705s1c1
Sequence:CCGGGCTCTACTCGCCAGCGTCCGACTCGAGTCGGACGCTGGCGAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-474s1c1
Sequence:CCGGGCGCTTCAAGCGCGCTGAGCTCTCGAGAGCTCAGCGCGCTTGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-248s1c1
Sequence:CCGGGCCGTCTAACGCTGGCAGCCACTCGAGTGGCTGCCAGCGTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-200s21c1
Sequence:CCGGACTCATACATCGCGCTCATTGCTCGAGCAATGAGCGCGATGTATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-439s21c1
Sequence:CCGGATGTTCGACAACGGTAGCTTCCTCGAGGAAGCTACCGTTGTCGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-430s21c1
Sequence:CCGGGCCGCTGACATGTTCGACAACCTCGAGGTTGTCGAACATGTCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015758
FOXE3 MISSION shRNA shRNA Plasmid DNA
forkhead box E3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-171s1c1
Sequence:CCGGGCGGCCACTACAGCGTGGGAACTCGAGTTCCCACGCTGTAGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-351s1c1
Sequence:CCGGCCTCAACGACTGTTTCGTCAACTCGAGTTGACGAAACAGTCGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-705s1c1
Sequence:CCGGGCTCTACTCGCCAGCGTCCGACTCGAGTCGGACGCTGGCGAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-474s1c1
Sequence:CCGGGCGCTTCAAGCGCGCTGAGCTCTCGAGAGCTCAGCGCGCTTGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-248s1c1
Sequence:CCGGGCCGTCTAACGCTGGCAGCCACTCGAGTGGCTGCCAGCGTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-200s21c1
Sequence:CCGGACTCATACATCGCGCTCATTGCTCGAGCAATGAGCGCGATGTATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-439s21c1
Sequence:CCGGATGTTCGACAACGGTAGCTTCCTCGAGGAAGCTACCGTTGTCGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-430s21c1
Sequence:CCGGGCCGCTGACATGTTCGACAACCTCGAGGTTGTCGAACATGTCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015758
FOXE3 MISSION shRNA Lentiviral Transduction Particles
forkhead box E3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-171s1c1
Sequence:CCGGGCGGCCACTACAGCGTGGGAACTCGAGTTCCCACGCTGTAGTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-351s1c1
Sequence:CCGGCCTCAACGACTGTTTCGTCAACTCGAGTTGACGAAACAGTCGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-705s1c1
Sequence:CCGGGCTCTACTCGCCAGCGTCCGACTCGAGTCGGACGCTGGCGAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-474s1c1
Sequence:CCGGGCGCTTCAAGCGCGCTGAGCTCTCGAGAGCTCAGCGCGCTTGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015758.1-248s1c1
Sequence:CCGGGCCGTCTAACGCTGGCAGCCACTCGAGTGGCTGCCAGCGTTAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-200s21c1
Sequence:CCGGACTCATACATCGCGCTCATTGCTCGAGCAATGAGCGCGATGTATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-439s21c1
Sequence:CCGGATGTTCGACAACGGTAGCTTCCTCGAGGAAGCTACCGTTGTCGAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015758.1-430s21c1
Sequence:CCGGGCCGCTGACATGTTCGACAACCTCGAGGTTGTCGAACATGTCAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012186
FOXE3 MISSION shRNA Bacterial Glycerol Stock
forkhead box E3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012186.1-1623s1c1
Sequence:CCGGCGACTGTACTTCATCAACCTTCTCGAGAAGGTTGATGAAGTACAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-286s1c1
Sequence:CCGGGCCGCGTTCTCTGGCTTCCCTCTCGAGAGGGAAGCCAGAGAACGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-894s1c1
Sequence:CCGGCGCGCGTCTGTTCAGCGTCGACTCGAGTCGACGCTGAACAGACGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-555s1c1
Sequence:CCGGCATCACCGAACGCTTTGCCTTCTCGAGAAGGCAAAGCGTTCGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-549s1c1
Sequence:CCGGCCGCTTCATCACCGAACGCTTCTCGAGAAGCGTTCGGTGATGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012186.2-1623s21c1
Sequence:CCGGCATCAACCTTCTCTCATGTTTCTCGAGAAACATGAGAGAAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012186.2-556s21c1
Sequence:CCGGCTTTGCCTTCTACCGCGACAGCTCGAGCTGTCGCGGTAGAAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012186
FOXE3 MISSION shRNA shRNA Plasmid DNA
forkhead box E3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012186.1-1623s1c1
Sequence:CCGGCGACTGTACTTCATCAACCTTCTCGAGAAGGTTGATGAAGTACAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-286s1c1
Sequence:CCGGGCCGCGTTCTCTGGCTTCCCTCTCGAGAGGGAAGCCAGAGAACGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-894s1c1
Sequence:CCGGCGCGCGTCTGTTCAGCGTCGACTCGAGTCGACGCTGAACAGACGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-555s1c1
Sequence:CCGGCATCACCGAACGCTTTGCCTTCTCGAGAAGGCAAAGCGTTCGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-549s1c1
Sequence:CCGGCCGCTTCATCACCGAACGCTTCTCGAGAAGCGTTCGGTGATGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012186.2-1623s21c1
Sequence:CCGGCATCAACCTTCTCTCATGTTTCTCGAGAAACATGAGAGAAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012186.2-556s21c1
Sequence:CCGGCTTTGCCTTCTACCGCGACAGCTCGAGCTGTCGCGGTAGAAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012186
FOXE3 MISSION shRNA Lentiviral Transduction Particles
forkhead box E3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012186.1-1623s1c1
Sequence:CCGGCGACTGTACTTCATCAACCTTCTCGAGAAGGTTGATGAAGTACAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-286s1c1
Sequence:CCGGGCCGCGTTCTCTGGCTTCCCTCTCGAGAGGGAAGCCAGAGAACGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-894s1c1
Sequence:CCGGCGCGCGTCTGTTCAGCGTCGACTCGAGTCGACGCTGAACAGACGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-555s1c1
Sequence:CCGGCATCACCGAACGCTTTGCCTTCTCGAGAAGGCAAAGCGTTCGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012186.1-549s1c1
Sequence:CCGGCCGCTTCATCACCGAACGCTTCTCGAGAAGCGTTCGGTGATGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012186.2-1623s21c1
Sequence:CCGGCATCAACCTTCTCTCATGTTTCTCGAGAAACATGAGAGAAGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012186.2-556s21c1
Sequence:CCGGCTTTGCCTTCTACCGCGACAGCTCGAGCTGTCGCGGTAGAAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks