EMAIL THIS PAGE TO A FRIEND

FOXF1

forkhead box F1

88 Gene Product Result for
Synonyms: ACDMPV FKHL5 FREAC1
UniProtKB ID: Q12946, B2RAF4, Q5FWE5
Gene ID:
Human(2294) Summary: This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the regulation of pulmonary genes as well as embryonic development. [provided by RefSeq, Jul 2008]
Mouse(15227) forkhead box F1
Rat(687536) forkhead box F1
Zebrafish(566407) forkhead box F1
dog(489672) forkhead box F1
cow(524813) forkhead box F1
domestic cat(101094468) forkhead box F1
chicken(395624) forkhead box F1
naked mole-rat(101706576) forkhead box F1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001451 Rosetta Predictions human pricing
XM_001079002 Rosetta Predictions rat pricing
NM_010426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164925 predicted 1141
2 SASI_Hs01_00164926 predicted 1154
3 SASI_Hs01_00164927 predicted 1054
4 SASI_Hs02_00331879 predicted 353
5 SASI_Hs01_00164929 predicted 1049
6 SASI_Hs01_00164930 predicted 1052
7 SASI_Hs01_00164924 predicted 1265
8 SASI_Hs02_00331880 predicted 1363
9 SASI_Hs01_00164928 predicted 1246
10 SASI_Hs02_00331881 predicted 1526
11 SASI_Hs01_00164931 predicted 1335
12 SASI_Hs01_00164932 predicted 1553
13 SASI_Hs01_00164933 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362808 predicted 1226
2 SASI_Rn02_00362809 predicted 1796
3 SASI_Rn02_00362810 predicted 1303
4 SASI_Rn02_00362811 predicted 1202
5 SASI_Rn02_00362812 predicted 687
6 SASI_Rn02_00362813 predicted 1319
7 SASI_Rn02_00362814 predicted 1131
8 SASI_Rn02_00362815 predicted 748
9 SASI_Rn02_00362816 predicted 1268
10 SASI_Rn02_00362817 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056240 predicted 510
2 SASI_Mm01_00056241 predicted 697
3 SASI_Mm01_00056242 predicted 372
4 SASI_Mm01_00056243 predicted 518
5 SASI_Mm01_00056244 predicted 571
6 SASI_Mm01_00056245 predicted 765
7 SASI_Mm01_00056246 predicted 682
8 SASI_Mm01_00056247 predicted 287
9 SASI_Mm01_00056248 predicted 811
10 SASI_Mm01_00056249 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001451
FOXF1 MISSION shRNA Bacterial Glycerol Stock
forkhead box F1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1238s21c1
Sequence:CCGGCCGGCACAAGAAACTGCTTTCCTCGAGGAAAGCAGTTTCTTGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1584s21c1
Sequence:CCGGTGAGACCAATCATTATCAAATCTCGAGATTTGATAATGATTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1418s21c1
Sequence:CCGGGACTGCAGCCATCGGTAAATACTCGAGTATTTACCGATGGCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1670s21c1
Sequence:CCGGGAATGCGCAAGTCTCCCTTTACTCGAGTAAAGGGAGACTTGCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001451.2-975s21c1
Sequence:CCGGAGCCGTATCTGCACCAGAACACTCGAGTGTTCTGGTGCAGATACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001451.1-2350s1c1
Sequence:CCGGGCAGCATTTGTGACACGTATTCTCGAGAATACGTGTCACAAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-861s1c1
Sequence:CCGGCGCCTCTTATATCAAGCAGCACTCGAGTGCTGCTTGATATAAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-1127s1c1
Sequence:CCGGCCTACCAAGACATCAAGCCTTCTCGAGAAGGCTTGATGTCTTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-198s1c1
Sequence:CCGGCATCCAGAGTTCACCCACCAACTCGAGTTGGTGGGTGAACTCTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-1023s1c1
Sequence:CCGGGCCCAGCATGTGTGACCGAAACTCGAGTTTCGGTCACACATGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001451
FOXF1 MISSION shRNA shRNA Plasmid DNA
forkhead box F1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1238s21c1
Sequence:CCGGCCGGCACAAGAAACTGCTTTCCTCGAGGAAAGCAGTTTCTTGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1584s21c1
Sequence:CCGGTGAGACCAATCATTATCAAATCTCGAGATTTGATAATGATTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1418s21c1
Sequence:CCGGGACTGCAGCCATCGGTAAATACTCGAGTATTTACCGATGGCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1670s21c1
Sequence:CCGGGAATGCGCAAGTCTCCCTTTACTCGAGTAAAGGGAGACTTGCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001451.2-975s21c1
Sequence:CCGGAGCCGTATCTGCACCAGAACACTCGAGTGTTCTGGTGCAGATACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001451.1-2350s1c1
Sequence:CCGGGCAGCATTTGTGACACGTATTCTCGAGAATACGTGTCACAAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-861s1c1
Sequence:CCGGCGCCTCTTATATCAAGCAGCACTCGAGTGCTGCTTGATATAAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-1127s1c1
Sequence:CCGGCCTACCAAGACATCAAGCCTTCTCGAGAAGGCTTGATGTCTTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-198s1c1
Sequence:CCGGCATCCAGAGTTCACCCACCAACTCGAGTTGGTGGGTGAACTCTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-1023s1c1
Sequence:CCGGGCCCAGCATGTGTGACCGAAACTCGAGTTTCGGTCACACATGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001451
FOXF1 MISSION shRNA Lentiviral Transduction Particles
forkhead box F1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1238s21c1
Sequence:CCGGCCGGCACAAGAAACTGCTTTCCTCGAGGAAAGCAGTTTCTTGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1584s21c1
Sequence:CCGGTGAGACCAATCATTATCAAATCTCGAGATTTGATAATGATTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1418s21c1
Sequence:CCGGGACTGCAGCCATCGGTAAATACTCGAGTATTTACCGATGGCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001451.2-1670s21c1
Sequence:CCGGGAATGCGCAAGTCTCCCTTTACTCGAGTAAAGGGAGACTTGCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001451.2-975s21c1
Sequence:CCGGAGCCGTATCTGCACCAGAACACTCGAGTGTTCTGGTGCAGATACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001451.1-2350s1c1
Sequence:CCGGGCAGCATTTGTGACACGTATTCTCGAGAATACGTGTCACAAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-861s1c1
Sequence:CCGGCGCCTCTTATATCAAGCAGCACTCGAGTGCTGCTTGATATAAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-1127s1c1
Sequence:CCGGCCTACCAAGACATCAAGCCTTCTCGAGAAGGCTTGATGTCTTGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-198s1c1
Sequence:CCGGCATCCAGAGTTCACCCACCAACTCGAGTTGGTGGGTGAACTCTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001451.1-1023s1c1
Sequence:CCGGGCCCAGCATGTGTGACCGAAACTCGAGTTTCGGTCACACATGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010426
FOXF1 MISSION shRNA Bacterial Glycerol Stock
forkhead box F1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-139s1c1
Sequence:CCGGAGCGAGATCTACCAGTTTCTTCTCGAGAAGAAACTGGTAGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-895s1c1
Sequence:CCGGCTGCAAGGCATCCCTCGGTATCTCGAGATACCGAGGGATGCCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-703s1c1
Sequence:CCGGGCCGTTTACTCCAGCTCTGCACTCGAGTGCAGAGCTGGAGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-297s1c1
Sequence:CCGGCGATCCGGCTAGCGAGTTTATCTCGAGATAAACTCGCTAGCCGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-851s1c1
Sequence:CCGGAGCAGCCATACCTTCACCAAACTCGAGTTTGGTGAAGGTATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010426
FOXF1 MISSION shRNA shRNA Plasmid DNA
forkhead box F1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-139s1c1
Sequence:CCGGAGCGAGATCTACCAGTTTCTTCTCGAGAAGAAACTGGTAGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-895s1c1
Sequence:CCGGCTGCAAGGCATCCCTCGGTATCTCGAGATACCGAGGGATGCCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-703s1c1
Sequence:CCGGGCCGTTTACTCCAGCTCTGCACTCGAGTGCAGAGCTGGAGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-297s1c1
Sequence:CCGGCGATCCGGCTAGCGAGTTTATCTCGAGATAAACTCGCTAGCCGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-851s1c1
Sequence:CCGGAGCAGCCATACCTTCACCAAACTCGAGTTTGGTGAAGGTATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010426
FOXF1 MISSION shRNA Lentiviral Transduction Particles
forkhead box F1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-139s1c1
Sequence:CCGGAGCGAGATCTACCAGTTTCTTCTCGAGAAGAAACTGGTAGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-895s1c1
Sequence:CCGGCTGCAAGGCATCCCTCGGTATCTCGAGATACCGAGGGATGCCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-703s1c1
Sequence:CCGGGCCGTTTACTCCAGCTCTGCACTCGAGTGCAGAGCTGGAGTAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-297s1c1
Sequence:CCGGCGATCCGGCTAGCGAGTTTATCTCGAGATAAACTCGCTAGCCGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010426.1-851s1c1
Sequence:CCGGAGCAGCCATACCTTCACCAAACTCGAGTTTGGTGAAGGTATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks