EMAIL THIS PAGE TO A FRIEND

FOXF2

forkhead box F2

105 Gene Product Result for
Synonyms: FKHL6 FREAC-2 FREAC2
UniProtKB ID: Q12947, Q5TGJ1, Q9UQ85
Gene ID:
Human(2295) Summary: FOXF2 encodes forkhead box F2, one of many human homologues of the Drosophila melanogaster transcription factor forkhead. FOXF2 is expressed in lung and placenta, and has been shown to transcriptionally activate several lung-specific genes. [provided by RefSeq, Jul 2008]
Mouse(14238) forkhead box F2
Rat(364707) forkhead box F2
naked mole-rat(101721820) forkhead box F2
domestic cat(101089937) forkhead box F2
cow(529218) forkhead box F2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001452 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018121 MISSION® esiRNA esiRNA targeting human FOXF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001452 Rosetta Predictions human pricing
XM_001067171 Rosetta Predictions rat pricing
XR_007069 Rosetta Predictions rat pricing
NM_010225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238475 predicted 1333
2 SASI_Hs01_00238476 predicted 1503
3 SASI_Hs01_00238477 predicted 1369
4 SASI_Hs01_00238479 predicted 1523
5 SASI_Hs01_00238480 predicted 1514
6 SASI_Hs01_00238481 predicted 1307
7 SASI_Hs01_00238482 predicted 1422
8 SASI_Hs01_00238484 predicted 1371
9 SASI_Hs02_00331882 predicted 1527
10 SASI_Hs02_00331883 predicted 1241
11 SASI_Hs01_00238478 predicted 1571
12 SASI_Hs01_00238483 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320117 predicted 1325
2 SASI_Rn02_00320118 predicted 481
3 SASI_Rn02_00320119 predicted 1229
4 SASI_Rn02_00320120 predicted 629
5 SASI_Rn02_00320121 predicted 1339
6 SASI_Rn02_00320122 predicted 1329
7 SASI_Rn02_00320123 predicted 1063
8 SASI_Rn02_00320124 predicted 1346
9 SASI_Rn02_00320125 predicted 1192
10 SASI_Rn02_00320126 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181521 predicted 346
2 SASI_Rn02_00413596 predicted 2089
3 SASI_Rn02_00413597 predicted 692
4 SASI_Rn02_00413598 predicted 696
5 SASI_Rn01_00181523 predicted 1957
6 SASI_Rn02_00413599 predicted 344
7 SASI_Rn02_00413600 predicted 350
8 SASI_Rn01_00181525 predicted 340
9 SASI_Rn02_00413601 predicted 502
10 SASI_Rn01_00181529 predicted 686
11 SASI_Rn01_00181520 predicted 704
12 SASI_Rn01_00181522 predicted 1700
13 SASI_Rn01_00181524 predicted 1716
14 SASI_Rn01_00181526 predicted 1479
15 SASI_Rn01_00181527 predicted 1512
16 SASI_Rn01_00181528 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067044 predicted 1024
2 SASI_Mm01_00067045 predicted 1017
3 SASI_Mm01_00067046 predicted 1618
4 SASI_Mm01_00067047 predicted 1284
5 SASI_Mm01_00067048 predicted 1409
6 SASI_Mm01_00067049 predicted 925
7 SASI_Mm01_00067050 predicted 1285
8 SASI_Mm01_00067051 predicted 902
9 SASI_Mm01_00067052 predicted 1626
10 SASI_Mm01_00067053 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010225
VALIDATED
FOXF2 MISSION shRNA Bacterial Glycerol Stock
forkhead box F2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010225.1-2150s1c1
Sequence:CCGGCCAAAGAACATTGTGAAGAAACTCGAGTTTCTTCACAATGTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-905s1c1
Sequence:CCGGGCTCTCAAACCCATGTACCATCTCGAGATGGTACATGGGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-1615s1c1
Sequence:CCGGCCAAGATATTAAGCCCTGTGTCTCGAGACACAGGGCTTAATATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-1616s1c1
Sequence:CCGGCAAGATATTAAGCCCTGTGTTCTCGAGAACACAGGGCTTAATATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010225.1-1569s1c1
Sequence:CCGGCTTCCGCTAGTGGCTCTTATTCTCGAGAATAAGAGCCACTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1606s21c1
Sequence:CCGGGAGCGTGTGCCAAGATATTAACTCGAGTTAATATCTTGGCACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010225.1-1804s21c1
Sequence:CCGGGAGTTCTGCTCACCGATATTTCTCGAGAAATATCGGTGAGCAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1569s21c1
Sequence:CCGGCTTCCGCTAGTGGCTCTTATTCTCGAGAATAAGAGCCACTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-470s21c1
Sequence:CCGGTGTGCCTCGTCCTCTTCTAACCTCGAGGTTAGAAGAGGACGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1536s21c1
Sequence:CCGGTCCTCAATTTCAATGGCATTTCTCGAGAAATGCCATTGAAATTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010225
VALIDATED
FOXF2 MISSION shRNA shRNA Plasmid DNA
forkhead box F2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010225.1-2150s1c1
Sequence:CCGGCCAAAGAACATTGTGAAGAAACTCGAGTTTCTTCACAATGTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-905s1c1
Sequence:CCGGGCTCTCAAACCCATGTACCATCTCGAGATGGTACATGGGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-1615s1c1
Sequence:CCGGCCAAGATATTAAGCCCTGTGTCTCGAGACACAGGGCTTAATATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-1616s1c1
Sequence:CCGGCAAGATATTAAGCCCTGTGTTCTCGAGAACACAGGGCTTAATATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010225.1-1569s1c1
Sequence:CCGGCTTCCGCTAGTGGCTCTTATTCTCGAGAATAAGAGCCACTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1606s21c1
Sequence:CCGGGAGCGTGTGCCAAGATATTAACTCGAGTTAATATCTTGGCACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010225.1-1804s21c1
Sequence:CCGGGAGTTCTGCTCACCGATATTTCTCGAGAAATATCGGTGAGCAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1569s21c1
Sequence:CCGGCTTCCGCTAGTGGCTCTTATTCTCGAGAATAAGAGCCACTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-470s21c1
Sequence:CCGGTGTGCCTCGTCCTCTTCTAACCTCGAGGTTAGAAGAGGACGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1536s21c1
Sequence:CCGGTCCTCAATTTCAATGGCATTTCTCGAGAAATGCCATTGAAATTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010225
VALIDATED
FOXF2 MISSION shRNA Lentiviral Transduction Particles
forkhead box F2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010225.1-2150s1c1
Sequence:CCGGCCAAAGAACATTGTGAAGAAACTCGAGTTTCTTCACAATGTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-905s1c1
Sequence:CCGGGCTCTCAAACCCATGTACCATCTCGAGATGGTACATGGGTTTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-1615s1c1
Sequence:CCGGCCAAGATATTAAGCCCTGTGTCTCGAGACACAGGGCTTAATATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010225.1-1616s1c1
Sequence:CCGGCAAGATATTAAGCCCTGTGTTCTCGAGAACACAGGGCTTAATATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010225.1-1569s1c1
Sequence:CCGGCTTCCGCTAGTGGCTCTTATTCTCGAGAATAAGAGCCACTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1606s21c1
Sequence:CCGGGAGCGTGTGCCAAGATATTAACTCGAGTTAATATCTTGGCACACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010225.1-1804s21c1
Sequence:CCGGGAGTTCTGCTCACCGATATTTCTCGAGAAATATCGGTGAGCAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1569s21c1
Sequence:CCGGCTTCCGCTAGTGGCTCTTATTCTCGAGAATAAGAGCCACTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-470s21c1
Sequence:CCGGTGTGCCTCGTCCTCTTCTAACCTCGAGGTTAGAAGAGGACGAGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010225.1-1536s21c1
Sequence:CCGGTCCTCAATTTCAATGGCATTTCTCGAGAAATGCCATTGAAATTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001452
VALIDATED
FOXF2 MISSION shRNA Bacterial Glycerol Stock
forkhead box F2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1245s1c1
Sequence:CCGGGCAGAGCTACTTGCACCAGAACTCGAGTTCTGGTGCAAGTAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001452.1-1909s1c1
Sequence:CCGGCCCAGACACTACATTTGGATACTCGAGTATCCAAATGTAGTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1342s1c1
Sequence:CCGGGTCCTCAACTTCAATGGGATTCTCGAGAATCCCATTGAAGTTGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001452.1-1386s1c1
Sequence:CCGGCGGGTCGTATTATCACCATCACTCGAGTGATGGTGATAATACGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1412s1c1
Sequence:CCGGAGAGCGTCTGTCAGGATATTACTCGAGTAATATCCTGACAGACGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1295s21c1
Sequence:CCGGCCCGTTACCAGCATCACTCTACTCGAGTAGAGTGATGCTGGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1437s21c1
Sequence:CCGGCTGCGTCATGTGAACGGAAAGCTCGAGCTTTCCGTTCACATGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001452.1-1909s21c1
Sequence:CCGGCCCAGACACTACATTTGGATACTCGAGTATCCAAATGTAGTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1412s21c1
Sequence:CCGGAGAGCGTCTGTCAGGATATTACTCGAGTAATATCCTGACAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1342s21c1
Sequence:CCGGGTCCTCAACTTCAATGGGATTCTCGAGAATCCCATTGAAGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001452
VALIDATED
FOXF2 MISSION shRNA shRNA Plasmid DNA
forkhead box F2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1245s1c1
Sequence:CCGGGCAGAGCTACTTGCACCAGAACTCGAGTTCTGGTGCAAGTAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001452.1-1909s1c1
Sequence:CCGGCCCAGACACTACATTTGGATACTCGAGTATCCAAATGTAGTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1342s1c1
Sequence:CCGGGTCCTCAACTTCAATGGGATTCTCGAGAATCCCATTGAAGTTGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001452.1-1386s1c1
Sequence:CCGGCGGGTCGTATTATCACCATCACTCGAGTGATGGTGATAATACGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1412s1c1
Sequence:CCGGAGAGCGTCTGTCAGGATATTACTCGAGTAATATCCTGACAGACGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1295s21c1
Sequence:CCGGCCCGTTACCAGCATCACTCTACTCGAGTAGAGTGATGCTGGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1437s21c1
Sequence:CCGGCTGCGTCATGTGAACGGAAAGCTCGAGCTTTCCGTTCACATGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001452.1-1909s21c1
Sequence:CCGGCCCAGACACTACATTTGGATACTCGAGTATCCAAATGTAGTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1412s21c1
Sequence:CCGGAGAGCGTCTGTCAGGATATTACTCGAGTAATATCCTGACAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1342s21c1
Sequence:CCGGGTCCTCAACTTCAATGGGATTCTCGAGAATCCCATTGAAGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001452
VALIDATED
FOXF2 MISSION shRNA Lentiviral Transduction Particles
forkhead box F2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1245s1c1
Sequence:CCGGGCAGAGCTACTTGCACCAGAACTCGAGTTCTGGTGCAAGTAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001452.1-1909s1c1
Sequence:CCGGCCCAGACACTACATTTGGATACTCGAGTATCCAAATGTAGTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1342s1c1
Sequence:CCGGGTCCTCAACTTCAATGGGATTCTCGAGAATCCCATTGAAGTTGAGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001452.1-1386s1c1
Sequence:CCGGCGGGTCGTATTATCACCATCACTCGAGTGATGGTGATAATACGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001452.1-1412s1c1
Sequence:CCGGAGAGCGTCTGTCAGGATATTACTCGAGTAATATCCTGACAGACGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1295s21c1
Sequence:CCGGCCCGTTACCAGCATCACTCTACTCGAGTAGAGTGATGCTGGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1437s21c1
Sequence:CCGGCTGCGTCATGTGAACGGAAAGCTCGAGCTTTCCGTTCACATGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001452.1-1909s21c1
Sequence:CCGGCCCAGACACTACATTTGGATACTCGAGTATCCAAATGTAGTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1412s21c1
Sequence:CCGGAGAGCGTCTGTCAGGATATTACTCGAGTAATATCCTGACAGACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001452.1-1342s21c1
Sequence:CCGGGTCCTCAACTTCAATGGGATTCTCGAGAATCCCATTGAAGTTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks