EMAIL THIS PAGE TO A FRIEND

FOXG1

forkhead box G1

121 Gene Product Result for
Synonyms: BF1 BF2 FHKL3 FKH2 FKHL1 FKHL2 FKHL3 FKHL4 FOXG1A FOXG1B FOXG1C HBF-1 HBF-2 HBF-3 HBF-G2 HBF2 HFK1 HFK2 HFK3 KHL2 QIN
UniProtKB ID: P55316, A6NFY2, P55315, Q14488, Q86XT7
Gene ID:
Human(2290) Summary: This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]
Mouse(15228) forkhead box G1
Rat(24370) forkhead box G1
chicken(396110) forkhead box G1
domestic cat(101101476) forkhead box G1
cow(516947) forkhead box G1
dog(490636) forkhead box G1
sheep(101123074) forkhead box G1
naked mole-rat(101707442) forkhead box G1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005249 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005249 Rosetta Predictions human pricing
NM_012560 Rosetta Predictions rat pricing
NM_008241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104597 predicted 1031
2 SASI_Hs01_00104599 predicted 1457
3 SASI_Hs01_00104602 predicted 1161
4 SASI_Hs01_00104603 predicted 1462
5 SASI_Hs01_00104604 predicted 1427
6 SASI_Hs01_00104606 predicted 984
7 SASI_Hs02_00339267 predicted 966
8 SASI_Hs02_00339268 predicted 972
9 SASI_Hs02_00339269 predicted 1506
10 SASI_Hs02_00339270 predicted 1279
11 SASI_Hs01_00104598 predicted 1229
12 SASI_Hs01_00104600 predicted 1107
13 SASI_Hs01_00104601 predicted 1075
14 SASI_Hs01_00104605 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048974 predicted 1431
2 SASI_Rn01_00048975 predicted 1860
3 SASI_Rn01_00048976 predicted 2082
4 SASI_Rn02_00259671 predicted 2006
5 SASI_Rn01_00048977 predicted 1867
6 SASI_Rn01_00048978 predicted 2058
7 SASI_Rn01_00048979 predicted 1674
8 SASI_Rn01_00048980 predicted 1887
9 SASI_Rn01_00048982 predicted 2105
10 SASI_Rn01_00048983 predicted 1194
11 SASI_Rn01_00048981 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082548 predicted 1947
2 SASI_Mm02_00313430 predicted 2038
3 SASI_Mm01_00082550 predicted 1986
4 SASI_Mm01_00082552 predicted 2054
5 SASI_Mm01_00082553 predicted 2309
6 SASI_Mm01_00082554 predicted 2446
7 SASI_Mm01_00082555 predicted 1322
8 SASI_Mm01_00082556 predicted 2177
9 SASI_Mm01_00082557 predicted 2119
10 SASI_Mm02_00313431 predicted 2136
11 SASI_Mm01_00082549 predicted 1985
12 SASI_Mm01_00082551 predicted 2199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008241
VALIDATED
FOXG1 MISSION shRNA Bacterial Glycerol Stock
forkhead box G1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.2-1890s21c1
Sequence:CCGGCCCTGCCCTGTGAGTCTTTAACTCGAGTTAAAGACTCACAGGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008241.2-1990s21c1
Sequence:CCGGTTCCAACCCTTTAATACATTACTCGAGTAATGTATTAAAGGGTTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008241.1-1984s21c1
Sequence:CCGGGTCTTCTTCCAACCCTTTAATCTCGAGATTAAAGGGTTGGAAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1889s21c1
Sequence:CCGGACCCTGCCCTGTGAGTCTTTACTCGAGTAAAGACTCACAGGGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1144s21c1
Sequence:CCGGCCTGACGCTCAATGGCATCTACTCGAGTAGATGCCATTGAGCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1588s21c1
Sequence:CCGGGCTGGGCAACAACCACTCCTTCTCGAGAAGGAGTGGTTGTTGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008241.1-2660s21c1
Sequence:CCGGGCCTTCAGTTTGTGTTGTGTACTCGAGTACACAACACAAACTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-2660s1c1
Sequence:CCGGGCCTTCAGTTTGTGTTGTGTACTCGAGTACACAACACAAACTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1588s1c1
Sequence:CCGGGCTGGGCAACAACCACTCCTTCTCGAGAAGGAGTGGTTGTTGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1509s1c1
Sequence:CCGGGCACTTTGAGTTACAACGGGACTCGAGTCCCGTTGTAACTCAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1144s1c1
Sequence:CCGGCCTGACGCTCAATGGCATCTACTCGAGTAGATGCCATTGAGCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1145s1c1
Sequence:CCGGCTGACGCTCAATGGCATCTATCTCGAGATAGATGCCATTGAGCGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008241
VALIDATED
FOXG1 MISSION shRNA shRNA Plasmid DNA
forkhead box G1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.2-1890s21c1
Sequence:CCGGCCCTGCCCTGTGAGTCTTTAACTCGAGTTAAAGACTCACAGGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008241.2-1990s21c1
Sequence:CCGGTTCCAACCCTTTAATACATTACTCGAGTAATGTATTAAAGGGTTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008241.1-1984s21c1
Sequence:CCGGGTCTTCTTCCAACCCTTTAATCTCGAGATTAAAGGGTTGGAAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1889s21c1
Sequence:CCGGACCCTGCCCTGTGAGTCTTTACTCGAGTAAAGACTCACAGGGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1144s21c1
Sequence:CCGGCCTGACGCTCAATGGCATCTACTCGAGTAGATGCCATTGAGCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1588s21c1
Sequence:CCGGGCTGGGCAACAACCACTCCTTCTCGAGAAGGAGTGGTTGTTGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008241.1-2660s21c1
Sequence:CCGGGCCTTCAGTTTGTGTTGTGTACTCGAGTACACAACACAAACTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-2660s1c1
Sequence:CCGGGCCTTCAGTTTGTGTTGTGTACTCGAGTACACAACACAAACTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1588s1c1
Sequence:CCGGGCTGGGCAACAACCACTCCTTCTCGAGAAGGAGTGGTTGTTGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1509s1c1
Sequence:CCGGGCACTTTGAGTTACAACGGGACTCGAGTCCCGTTGTAACTCAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1144s1c1
Sequence:CCGGCCTGACGCTCAATGGCATCTACTCGAGTAGATGCCATTGAGCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1145s1c1
Sequence:CCGGCTGACGCTCAATGGCATCTATCTCGAGATAGATGCCATTGAGCGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008241
VALIDATED
FOXG1 MISSION shRNA Lentiviral Transduction Particles
forkhead box G1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.2-1890s21c1
Sequence:CCGGCCCTGCCCTGTGAGTCTTTAACTCGAGTTAAAGACTCACAGGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008241.2-1990s21c1
Sequence:CCGGTTCCAACCCTTTAATACATTACTCGAGTAATGTATTAAAGGGTTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008241.1-1984s21c1
Sequence:CCGGGTCTTCTTCCAACCCTTTAATCTCGAGATTAAAGGGTTGGAAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1889s21c1
Sequence:CCGGACCCTGCCCTGTGAGTCTTTACTCGAGTAAAGACTCACAGGGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1144s21c1
Sequence:CCGGCCTGACGCTCAATGGCATCTACTCGAGTAGATGCCATTGAGCGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008241.1-1588s21c1
Sequence:CCGGGCTGGGCAACAACCACTCCTTCTCGAGAAGGAGTGGTTGTTGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008241.1-2660s21c1
Sequence:CCGGGCCTTCAGTTTGTGTTGTGTACTCGAGTACACAACACAAACTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-2660s1c1
Sequence:CCGGGCCTTCAGTTTGTGTTGTGTACTCGAGTACACAACACAAACTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1588s1c1
Sequence:CCGGGCTGGGCAACAACCACTCCTTCTCGAGAAGGAGTGGTTGTTGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1509s1c1
Sequence:CCGGGCACTTTGAGTTACAACGGGACTCGAGTCCCGTTGTAACTCAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1144s1c1
Sequence:CCGGCCTGACGCTCAATGGCATCTACTCGAGTAGATGCCATTGAGCGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008241.1-1145s1c1
Sequence:CCGGCTGACGCTCAATGGCATCTATCTCGAGATAGATGCCATTGAGCGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005249
VALIDATED
FOXG1 MISSION shRNA Bacterial Glycerol Stock
forkhead box G1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005249.3-889s21c1
Sequence:CCGGCCACAATCTGTCCCTCAACAACTCGAGTTGTTGAGGGACAGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005249.3-832s21c1
Sequence:CCGGCATGAAGAACTTCCCTTACTACTCGAGTAGTAAGGGAAGTTCTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005249.3-1767s21c1
Sequence:CCGGCCCTCCCATTTCTGTACGTTTCTCGAGAAACGTACAGAAATGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005249.3-1160s21c1
Sequence:CCGGGCCAGCAGCACTTTGAGTTACCTCGAGGTAACTCAAAGTGCTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005249.3-1648s21c1
Sequence:CCGGTTCCAACCCTTTAATACATTACTCGAGTAATGTATTAAAGGGTTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005249.3-1767s1c1
Sequence:CCGGCCCTCCCATTTCTGTACGTTTCTCGAGAAACGTACAGAAATGGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005249.3-889s1c1
Sequence:CCGGCCACAATCTGTCCCTCAACAACTCGAGTTGTTGAGGGACAGATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005249.3-1558s1c1
Sequence:CCGGTGAGTCTTTAAGACCCTCTTTCTCGAGAAAGAGGGTCTTAAAGACTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005249.3-1610s1c1
Sequence:CCGGCTGTCTGATTATTTCACACATCTCGAGATGTGTGAAATAATCAGACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005249.3-832s1c1
Sequence:CCGGCATGAAGAACTTCCCTTACTACTCGAGTAGTAAGGGAAGTTCTTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005249
VALIDATED
FOXG1 MISSION shRNA shRNA Plasmid DNA
forkhead box G1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005249.3-889s21c1
Sequence:CCGGCCACAATCTGTCCCTCAACAACTCGAGTTGTTGAGGGACAGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005249.3-832s21c1
Sequence:CCGGCATGAAGAACTTCCCTTACTACTCGAGTAGTAAGGGAAGTTCTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005249.3-1767s21c1
Sequence:CCGGCCCTCCCATTTCTGTACGTTTCTCGAGAAACGTACAGAAATGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005249.3-1160s21c1
Sequence:CCGGGCCAGCAGCACTTTGAGTTACCTCGAGGTAACTCAAAGTGCTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005249.3-1648s21c1
Sequence:CCGGTTCCAACCCTTTAATACATTACTCGAGTAATGTATTAAAGGGTTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005249.3-1767s1c1
Sequence:CCGGCCCTCCCATTTCTGTACGTTTCTCGAGAAACGTACAGAAATGGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005249.3-889s1c1
Sequence:CCGGCCACAATCTGTCCCTCAACAACTCGAGTTGTTGAGGGACAGATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005249.3-1558s1c1
Sequence:CCGGTGAGTCTTTAAGACCCTCTTTCTCGAGAAAGAGGGTCTTAAAGACTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005249.3-1610s1c1
Sequence:CCGGCTGTCTGATTATTTCACACATCTCGAGATGTGTGAAATAATCAGACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005249.3-832s1c1
Sequence:CCGGCATGAAGAACTTCCCTTACTACTCGAGTAGTAAGGGAAGTTCTTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005249
VALIDATED
FOXG1 MISSION shRNA Lentiviral Transduction Particles
forkhead box G1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005249.3-889s21c1
Sequence:CCGGCCACAATCTGTCCCTCAACAACTCGAGTTGTTGAGGGACAGATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005249.3-832s21c1
Sequence:CCGGCATGAAGAACTTCCCTTACTACTCGAGTAGTAAGGGAAGTTCTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005249.3-1767s21c1
Sequence:CCGGCCCTCCCATTTCTGTACGTTTCTCGAGAAACGTACAGAAATGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005249.3-1160s21c1
Sequence:CCGGGCCAGCAGCACTTTGAGTTACCTCGAGGTAACTCAAAGTGCTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005249.3-1648s21c1
Sequence:CCGGTTCCAACCCTTTAATACATTACTCGAGTAATGTATTAAAGGGTTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005249.3-1767s1c1
Sequence:CCGGCCCTCCCATTTCTGTACGTTTCTCGAGAAACGTACAGAAATGGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005249.3-889s1c1
Sequence:CCGGCCACAATCTGTCCCTCAACAACTCGAGTTGTTGAGGGACAGATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005249.3-1558s1c1
Sequence:CCGGTGAGTCTTTAAGACCCTCTTTCTCGAGAAAGAGGGTCTTAAAGACTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005249.3-1610s1c1
Sequence:CCGGCTGTCTGATTATTTCACACATCTCGAGATGTGTGAAATAATCAGACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005249.3-832s1c1
Sequence:CCGGCATGAAGAACTTCCCTTACTACTCGAGTAGTAAGGGAAGTTCTTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)