EMAIL THIS PAGE TO A FRIEND

FOXH1

forkhead box H1

57 Gene Product Result for
Synonyms: FAST-1 FAST1
UniProtKB ID: O75593, D3DWM4
Gene ID:
Human(8928) Summary: FOXH1 encodes a human homolog of Xenopus forkhead activin signal transducer-1. FOXH1 protein binds SMAD2 and activates an activin response element via binding the DNA motif TGT(G/T)(T/G)ATT. [provided by RefSeq, Jul 2008]
Mouse(14106) forkhead box H1
Rat(300054) forkhead box H1
Zebrafish(57930) forkhead box H1
cow(493733) forkhead box H1
domestic cat(101081703) forkhead box H1
dog(482098) forkhead box H1
naked mole-rat(101717018) forkhead box H1
sheep(101115972) forkhead box H1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003923 Rosetta Predictions human pricing
XM_001075361 Rosetta Predictions rat pricing
XM_235454 Rosetta Predictions rat pricing
NM_007989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108856 predicted 1065
2 SASI_Hs01_00108857 predicted 1407
3 SASI_Hs01_00108859 predicted 648
4 SASI_Hs01_00108860 predicted 693
5 SASI_Hs01_00108861 predicted 1410
6 SASI_Hs01_00108862 predicted 694
7 SASI_Hs01_00108863 predicted 734
8 SASI_Hs01_00108864 predicted 1063
9 SASI_Hs02_00336573 predicted 1070
10 SASI_Hs01_00108865 predicted 644
11 SASI_Hs01_00108858 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349488 predicted 861
2 SASI_Rn02_00349489 predicted 926
3 SASI_Rn02_00349490 predicted 941
4 SASI_Rn02_00349491 predicted 950
5 SASI_Rn02_00349492 predicted 337
6 SASI_Rn02_00349493 predicted 217
7 SASI_Rn02_00349494 predicted 263
8 SASI_Rn02_00349495 predicted 715
9 SASI_Rn02_00349496 predicted 881
10 SASI_Rn02_00349497 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389319 predicted 254
2 SASI_Rn02_00389320 predicted 339
3 SASI_Rn02_00389321 predicted 240
4 SASI_Rn02_00389322 predicted 421
5 SASI_Rn02_00389323 predicted 336
6 SASI_Rn02_00389324 predicted 454
7 SASI_Rn02_00389325 predicted 242
8 SASI_Rn02_00389326 predicted 237
9 SASI_Rn02_00389327 predicted 441
10 SASI_Rn02_00389328 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112900 predicted 924
2 SASI_Mm01_00112901 predicted 251
3 SASI_Mm01_00112902 predicted 756
4 SASI_Mm01_00112903 predicted 859
5 SASI_Mm01_00112904 predicted 933
6 SASI_Mm01_00112905 predicted 951
7 SASI_Mm01_00112906 predicted 338
8 SASI_Mm01_00112907 predicted 206
9 SASI_Mm01_00112908 predicted 965
10 SASI_Mm01_00112909 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007989
FOXH1 MISSION shRNA Bacterial Glycerol Stock
forkhead box H1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-952s1c1
Sequence:CCGGCCCATCTATACGCCCAATGTACTCGAGTACATTGGGCGTATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-940s1c1
Sequence:CCGGACTTCTTACTTGCCCATCTATCTCGAGATAGATGGGCAAGTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-963s1c1
Sequence:CCGGGCCCAATGTAGTAATGCCCTTCTCGAGAAGGGCATTACTACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-348s1c1
Sequence:CCGGCCTTTCCTCTAATCGGTGCTTCTCGAGAAGCACCGATTAGAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-213s21c1
Sequence:CCGGGCCATGATCGCCTTGGTAATTCTCGAGAATTACCAAGGCGATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-620s21c1
Sequence:CCGGCCCTGGGAAAGAATCCACATGCTCGAGCATGTGGATTCTTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-173s21c1
Sequence:CCGGGAGATACCTACGGCATGACAACTCGAGTTGTCATGCCGTAGGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-298s21c1
Sequence:CCGGCCTTCTTCAGGGACGACTATGCTCGAGCATAGTCGTCCCTGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007989
FOXH1 MISSION shRNA shRNA Plasmid DNA
forkhead box H1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-952s1c1
Sequence:CCGGCCCATCTATACGCCCAATGTACTCGAGTACATTGGGCGTATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-940s1c1
Sequence:CCGGACTTCTTACTTGCCCATCTATCTCGAGATAGATGGGCAAGTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-963s1c1
Sequence:CCGGGCCCAATGTAGTAATGCCCTTCTCGAGAAGGGCATTACTACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-348s1c1
Sequence:CCGGCCTTTCCTCTAATCGGTGCTTCTCGAGAAGCACCGATTAGAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-213s21c1
Sequence:CCGGGCCATGATCGCCTTGGTAATTCTCGAGAATTACCAAGGCGATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-620s21c1
Sequence:CCGGCCCTGGGAAAGAATCCACATGCTCGAGCATGTGGATTCTTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-173s21c1
Sequence:CCGGGAGATACCTACGGCATGACAACTCGAGTTGTCATGCCGTAGGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-298s21c1
Sequence:CCGGCCTTCTTCAGGGACGACTATGCTCGAGCATAGTCGTCCCTGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007989
FOXH1 MISSION shRNA Lentiviral Transduction Particles
forkhead box H1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-952s1c1
Sequence:CCGGCCCATCTATACGCCCAATGTACTCGAGTACATTGGGCGTATAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-940s1c1
Sequence:CCGGACTTCTTACTTGCCCATCTATCTCGAGATAGATGGGCAAGTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-963s1c1
Sequence:CCGGGCCCAATGTAGTAATGCCCTTCTCGAGAAGGGCATTACTACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007989.1-348s1c1
Sequence:CCGGCCTTTCCTCTAATCGGTGCTTCTCGAGAAGCACCGATTAGAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-213s21c1
Sequence:CCGGGCCATGATCGCCTTGGTAATTCTCGAGAATTACCAAGGCGATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-620s21c1
Sequence:CCGGCCCTGGGAAAGAATCCACATGCTCGAGCATGTGGATTCTTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-173s21c1
Sequence:CCGGGAGATACCTACGGCATGACAACTCGAGTTGTCATGCCGTAGGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007989.3-298s21c1
Sequence:CCGGCCTTCTTCAGGGACGACTATGCTCGAGCATAGTCGTCCCTGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003923
FOXH1 MISSION shRNA Bacterial Glycerol Stock
forkhead box H1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1413s1c1
Sequence:CCGGCACCTCCTACTTGCCTATCTACTCGAGTAGATAGGCAAGTAGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-801s1c1
Sequence:CCGGCGAGGGCTGGAAAGACTCCATCTCGAGATGGAGTCTTTCCAGCCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1425s1c1
Sequence:CCGGGCCTATCTACACTCCCAATGTCTCGAGACATTGGGAGTGTAGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-831s1c1
Sequence:CCGGCCTTTCCTCCAACCGATGCTTCTCGAGAAGCATCGGTTGGAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1540s1c1
Sequence:CCGGCCAGGGCTGCTCTGCGATCTACTCGAGTAGATCGCAGAGCAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-1069s21c1
Sequence:CCGGAGTGAGGGCTTCAGCATCAAGCTCGAGCTTGATGCTGAAGCCCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-1666s21c1
Sequence:CCGGTGCAGCCTGTGAGGCTCTTAACTCGAGTTAAGAGCCTCACAGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003923.2-1887s21c1
Sequence:CCGGTTCCTACACTCAGCGGCAAAGCTCGAGCTTTGCCGCTGAGTGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-698s21c1
Sequence:CCGGCCATGATCGCCTTGGTGATTCCTCGAGGAATCACCAAGGCGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003923
FOXH1 MISSION shRNA shRNA Plasmid DNA
forkhead box H1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1413s1c1
Sequence:CCGGCACCTCCTACTTGCCTATCTACTCGAGTAGATAGGCAAGTAGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-801s1c1
Sequence:CCGGCGAGGGCTGGAAAGACTCCATCTCGAGATGGAGTCTTTCCAGCCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1425s1c1
Sequence:CCGGGCCTATCTACACTCCCAATGTCTCGAGACATTGGGAGTGTAGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-831s1c1
Sequence:CCGGCCTTTCCTCCAACCGATGCTTCTCGAGAAGCATCGGTTGGAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1540s1c1
Sequence:CCGGCCAGGGCTGCTCTGCGATCTACTCGAGTAGATCGCAGAGCAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-1069s21c1
Sequence:CCGGAGTGAGGGCTTCAGCATCAAGCTCGAGCTTGATGCTGAAGCCCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-1666s21c1
Sequence:CCGGTGCAGCCTGTGAGGCTCTTAACTCGAGTTAAGAGCCTCACAGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003923.2-1887s21c1
Sequence:CCGGTTCCTACACTCAGCGGCAAAGCTCGAGCTTTGCCGCTGAGTGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-698s21c1
Sequence:CCGGCCATGATCGCCTTGGTGATTCCTCGAGGAATCACCAAGGCGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003923
FOXH1 MISSION shRNA Lentiviral Transduction Particles
forkhead box H1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1413s1c1
Sequence:CCGGCACCTCCTACTTGCCTATCTACTCGAGTAGATAGGCAAGTAGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-801s1c1
Sequence:CCGGCGAGGGCTGGAAAGACTCCATCTCGAGATGGAGTCTTTCCAGCCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1425s1c1
Sequence:CCGGGCCTATCTACACTCCCAATGTCTCGAGACATTGGGAGTGTAGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-831s1c1
Sequence:CCGGCCTTTCCTCCAACCGATGCTTCTCGAGAAGCATCGGTTGGAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003923.1-1540s1c1
Sequence:CCGGCCAGGGCTGCTCTGCGATCTACTCGAGTAGATCGCAGAGCAGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-1069s21c1
Sequence:CCGGAGTGAGGGCTTCAGCATCAAGCTCGAGCTTGATGCTGAAGCCCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-1666s21c1
Sequence:CCGGTGCAGCCTGTGAGGCTCTTAACTCGAGTTAAGAGCCTCACAGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003923.2-1887s21c1
Sequence:CCGGTTCCTACACTCAGCGGCAAAGCTCGAGCTTTGCCGCTGAGTGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003923.2-698s21c1
Sequence:CCGGCCATGATCGCCTTGGTGATTCCTCGAGGAATCACCAAGGCGATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks