EMAIL THIS PAGE TO A FRIEND

FOXI1

forkhead box I1

80 Gene Product Result for
Synonyms: FKH10 FKHL10 FREAC-6 FREAC6 HFH-3 HFH3
UniProtKB ID: Q12951, Q14518, Q66SR7, Q8N6L8
Gene ID:
Human(2299) Summary: This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it is possible that this gene plays an important role in the development of the cochlea and vestibulum, as well as embryogenesis. Mutations in this gene may be associated with the common cavity phenotype. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14233) forkhead box I1
Rat(287185) forkhead box I1
sheep(101104271) forkhead box I1
naked mole-rat(101706412) forkhead box I1
Zebrafish(353313) forkhead box i1
dog(489127) forkhead box I1
cow(539442) forkhead box I1
domestic cat(101097130) forkhead box I1
chicken(427613) forkhead box I1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F4307 Anti-FOXI1 (156-170) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F4182 Anti-FOXI1 (26-40) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2100841 Anti-FOXI1 (ab1) antibody produced in rabbit affinity isolated antibody canine, mouse, human, guinea pig, bovine, horse, zebrafish, rabbit
western blot pricing
AV32302 Anti-FOXI1 (AB1) antibody produced in rabbit affinity isolated antibody horse, human
western blot pricing
SAB2100842 Anti-FOXI1 (ab2) antibody produced in rabbit affinity isolated antibody rabbit, bovine, guinea pig, human, mouse, rat
western blot pricing
AV37338 Anti-FOXI1 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, rat, rabbit, human, bovine
western blot pricing
SAB2501502 Anti-FOXI1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1405816 Anti-FOXI1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4500922 Anti-FOXI1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
HPA071469 Anti-FOXI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031711 MISSION® esiRNA esiRNA human FOXI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012188 Rosetta Predictions human pricing
NM_144769 Rosetta Predictions human pricing
NM_001105776 Rosetta Predictions rat pricing
NM_023907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125261 predicted 1164
2 SASI_Hs01_00125262 predicted 1099
3 SASI_Hs01_00125263 predicted 1113
4 SASI_Hs01_00125264 predicted 1114
5 SASI_Hs01_00125265 predicted 1163
6 SASI_Hs01_00125266 predicted 1105
7 SASI_Hs01_00125267 predicted 1097
8 SASI_Hs01_00125268 predicted 1168
9 SASI_Hs02_00343812 predicted 1331
10 SASI_Hs01_00125269 predicted 1364
11 SASI_Hs01_00125270 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027446 predicted 879
2 SASI_Hs01_00027447 predicted 814
3 SASI_Hs01_00027448 predicted 822
4 SASI_Hs01_00027449 predicted 826
5 SASI_Hs01_00027450 predicted 877
6 SASI_Hs01_00027451 predicted 822
7 SASI_Hs01_00027452 predicted 813
8 SASI_Hs01_00027453 predicted 884
9 SASI_Hs02_00364712 predicted 1050
10 SASI_Hs01_00027454 predicted 1075
11 SASI_Hs01_00027455 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212416 predicted 662
2 SASI_Rn02_00212417 predicted 1230
3 SASI_Rn02_00212418 predicted 1374
4 SASI_Rn02_00212419 predicted 1432
5 SASI_Rn02_00212420 predicted 431
6 SASI_Rn02_00212421 predicted 1387
7 SASI_Rn02_00212422 predicted 1396
8 SASI_Rn02_00212423 predicted 1106
9 SASI_Rn02_00212424 predicted 1174
10 SASI_Rn02_00212425 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154757 predicted 1271
2 SASI_Mm01_00154758 predicted 651
3 SASI_Mm01_00154759 predicted 1312
4 SASI_Mm01_00154760 predicted 1349
5 SASI_Mm01_00154761 predicted 1337
6 SASI_Mm01_00154762 predicted 1360
7 SASI_Mm01_00154764 predicted 1103
8 SASI_Mm01_00154765 predicted 1133
9 SASI_Mm02_00327459 predicted 1117
10 SASI_Mm01_00154766 predicted 1068
11 SASI_Mm01_00154763 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012188
FOXI1 MISSION shRNA Bacterial Glycerol Stock
forkhead box I1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012188.4-661s21c1
Sequence:CCGGATGTTCGACAATGGAAATTTCCTCGAGGAAATTTCCATTGTCGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012188.4-1445s21c1
Sequence:CCGGGTACTGGCCACACTTACTATTCTCGAGAATAGTAAGTGTGGCCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012188.4-1170s21c1
Sequence:CCGGCACCGAGGTCTAGGTACAGAACTCGAGTTCTGTACCTAGACCTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012188.4-1524s21c1
Sequence:CCGGCAAGGAGGTTAAGTAACATTTCTCGAGAAATGTTACTTAACCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012188.3-1671s1c1
Sequence:CCGGGCTATGGCAAATATAGCGAAACTCGAGTTTCGCTATATTTGCCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-871s1c1
Sequence:CCGGCCTTGCCTTAACAGCTTCCTTCTCGAGAAGGAAGCTGTTAAGGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-984s1c1
Sequence:CCGGGCAGAACTCACTGACCTTCAACTCGAGTTGAAGGTCAGTGAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-132s1c1
Sequence:CCGGCCTCTACTATGAGAACTTCTTCTCGAGAAGAAGTTCTCATAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-888s1c1
Sequence:CCGGCCTTTCCTCTATGACAGCCTACTCGAGTAGGCTGTCATAGAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012188
FOXI1 MISSION shRNA shRNA Plasmid DNA
forkhead box I1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012188.4-661s21c1
Sequence:CCGGATGTTCGACAATGGAAATTTCCTCGAGGAAATTTCCATTGTCGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012188.4-1445s21c1
Sequence:CCGGGTACTGGCCACACTTACTATTCTCGAGAATAGTAAGTGTGGCCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012188.4-1170s21c1
Sequence:CCGGCACCGAGGTCTAGGTACAGAACTCGAGTTCTGTACCTAGACCTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012188.4-1524s21c1
Sequence:CCGGCAAGGAGGTTAAGTAACATTTCTCGAGAAATGTTACTTAACCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012188.3-1671s1c1
Sequence:CCGGGCTATGGCAAATATAGCGAAACTCGAGTTTCGCTATATTTGCCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-871s1c1
Sequence:CCGGCCTTGCCTTAACAGCTTCCTTCTCGAGAAGGAAGCTGTTAAGGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-984s1c1
Sequence:CCGGGCAGAACTCACTGACCTTCAACTCGAGTTGAAGGTCAGTGAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-132s1c1
Sequence:CCGGCCTCTACTATGAGAACTTCTTCTCGAGAAGAAGTTCTCATAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-888s1c1
Sequence:CCGGCCTTTCCTCTATGACAGCCTACTCGAGTAGGCTGTCATAGAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012188
FOXI1 MISSION shRNA Lentiviral Transduction Particles
forkhead box I1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012188.4-661s21c1
Sequence:CCGGATGTTCGACAATGGAAATTTCCTCGAGGAAATTTCCATTGTCGAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012188.4-1445s21c1
Sequence:CCGGGTACTGGCCACACTTACTATTCTCGAGAATAGTAAGTGTGGCCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012188.4-1170s21c1
Sequence:CCGGCACCGAGGTCTAGGTACAGAACTCGAGTTCTGTACCTAGACCTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012188.4-1524s21c1
Sequence:CCGGCAAGGAGGTTAAGTAACATTTCTCGAGAAATGTTACTTAACCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012188.3-1671s1c1
Sequence:CCGGGCTATGGCAAATATAGCGAAACTCGAGTTTCGCTATATTTGCCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-871s1c1
Sequence:CCGGCCTTGCCTTAACAGCTTCCTTCTCGAGAAGGAAGCTGTTAAGGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-984s1c1
Sequence:CCGGGCAGAACTCACTGACCTTCAACTCGAGTTGAAGGTCAGTGAGTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-132s1c1
Sequence:CCGGCCTCTACTATGAGAACTTCTTCTCGAGAAGAAGTTCTCATAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012188.3-888s1c1
Sequence:CCGGCCTTTCCTCTATGACAGCCTACTCGAGTAGGCTGTCATAGAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023907
FOXI1 MISSION shRNA Bacterial Glycerol Stock
forkhead box I1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1406s21c1
Sequence:CCGGTAGGGTCAGCTTGCCATTAATCTCGAGATTAATGGCAAGCTGACCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1343s21c1
Sequence:CCGGCAAGCCTTCTGGCTATCTATCCTCGAGGATAGATAGCCAGAAGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1436s21c1
Sequence:CCGGATTGGTTGAGCACTTACTATGCTCGAGCATAGTAAGTGCTCAACCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023907.4-915s21c1
Sequence:CCGGGAGTGGGACAAACCCTATTAGCTCGAGCTAATAGGGTTTGTCCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023907.2-1563s1c1
Sequence:CCGGGCCCAAGAAAGTTGTCAGTTTCTCGAGAAACTGACAACTTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-143s1c1
Sequence:CCGGCCCGGAGATGAATCTTTACTACTCGAGTAGTAAAGATTCATCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-1109s1c1
Sequence:CCGGCAACCAGTTCAGTCCACATTTCTCGAGAAATGTGGACTGAACTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-674s1c1
Sequence:CCGGCAACGGAAACTTTCGCAGGAACTCGAGTTCCTGCGAAAGTTTCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-1136s1c1
Sequence:CCGGCAGCATTAACACTAACGGTATCTCGAGATACCGTTAGTGTTAATGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023907
FOXI1 MISSION shRNA shRNA Plasmid DNA
forkhead box I1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1406s21c1
Sequence:CCGGTAGGGTCAGCTTGCCATTAATCTCGAGATTAATGGCAAGCTGACCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1343s21c1
Sequence:CCGGCAAGCCTTCTGGCTATCTATCCTCGAGGATAGATAGCCAGAAGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1436s21c1
Sequence:CCGGATTGGTTGAGCACTTACTATGCTCGAGCATAGTAAGTGCTCAACCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023907.4-915s21c1
Sequence:CCGGGAGTGGGACAAACCCTATTAGCTCGAGCTAATAGGGTTTGTCCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023907.2-1563s1c1
Sequence:CCGGGCCCAAGAAAGTTGTCAGTTTCTCGAGAAACTGACAACTTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-143s1c1
Sequence:CCGGCCCGGAGATGAATCTTTACTACTCGAGTAGTAAAGATTCATCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-1109s1c1
Sequence:CCGGCAACCAGTTCAGTCCACATTTCTCGAGAAATGTGGACTGAACTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-674s1c1
Sequence:CCGGCAACGGAAACTTTCGCAGGAACTCGAGTTCCTGCGAAAGTTTCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-1136s1c1
Sequence:CCGGCAGCATTAACACTAACGGTATCTCGAGATACCGTTAGTGTTAATGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023907
FOXI1 MISSION shRNA Lentiviral Transduction Particles
forkhead box I1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1406s21c1
Sequence:CCGGTAGGGTCAGCTTGCCATTAATCTCGAGATTAATGGCAAGCTGACCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1343s21c1
Sequence:CCGGCAAGCCTTCTGGCTATCTATCCTCGAGGATAGATAGCCAGAAGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023907.4-1436s21c1
Sequence:CCGGATTGGTTGAGCACTTACTATGCTCGAGCATAGTAAGTGCTCAACCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023907.4-915s21c1
Sequence:CCGGGAGTGGGACAAACCCTATTAGCTCGAGCTAATAGGGTTTGTCCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023907.2-1563s1c1
Sequence:CCGGGCCCAAGAAAGTTGTCAGTTTCTCGAGAAACTGACAACTTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-143s1c1
Sequence:CCGGCCCGGAGATGAATCTTTACTACTCGAGTAGTAAAGATTCATCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-1109s1c1
Sequence:CCGGCAACCAGTTCAGTCCACATTTCTCGAGAAATGTGGACTGAACTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-674s1c1
Sequence:CCGGCAACGGAAACTTTCGCAGGAACTCGAGTTCCTGCGAAAGTTTCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023907.2-1136s1c1
Sequence:CCGGCAGCATTAACACTAACGGTATCTCGAGATACCGTTAGTGTTAATGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)