EMAIL THIS PAGE TO A FRIEND

FOXI2

forkhead box I2

55 Gene Product Result for
UniProtKB ID: Q6ZQN5
Gene ID:
Mouse(270004) forkhead box I2
Rat(246073) forkhead box I2
Zebrafish(387256) forkhead box I2
cow(613373) forkhead box I2
dog(611594) forkhead box I2
naked mole-rat(101717474) forkhead box I2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_374844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207426 Rosetta Predictions human pricing
XM_001056035 Rosetta Predictions rat pricing
XM_341949 Rosetta Predictions rat pricing
NM_183193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075174 predicted 898
2 SASI_Hs01_00075175 predicted 811
3 SASI_Hs01_00075176 predicted 305
4 SASI_Hs01_00075177 predicted 814
5 SASI_Hs01_00075178 predicted 616
6 SASI_Hs01_00075179 predicted 888
7 SASI_Hs01_00075180 predicted 317
8 SASI_Hs02_00374064 predicted 501
9 SASI_Hs01_00075181 predicted 2206
10 SASI_Hs01_00075183 predicted 2585
11 SASI_Hs01_00075182 predicted 2647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281814 predicted 433
2 SASI_Rn02_00281815 predicted 579
3 SASI_Rn02_00281816 predicted 272
4 SASI_Rn02_00281817 predicted 428
5 SASI_Rn02_00281818 predicted 525
6 SASI_Rn02_00281819 predicted 363
7 SASI_Rn02_00281820 predicted 378
8 SASI_Rn02_00281821 predicted 723
9 SASI_Rn02_00281822 predicted 831
10 SASI_Rn02_00281823 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174899 predicted 427
2 SASI_Rn01_00174902 predicted 584
3 SASI_Rn01_00174904 predicted 272
4 SASI_Rn01_00174908 predicted 430
5 SASI_Rn02_00393603 predicted 526
6 SASI_Rn02_00393604 predicted 365
7 SASI_Rn02_00393605 predicted 372
8 SASI_Rn02_00393606 predicted 719
9 SASI_Rn02_00393607 predicted 829
10 SASI_Rn02_00393608 predicted 876
11 SASI_Rn01_00174900 predicted 536
12 SASI_Rn01_00174901 predicted 619
13 SASI_Rn01_00174903 predicted 609
14 SASI_Rn01_00174905 predicted 603
15 SASI_Rn01_00174906 predicted 493
16 SASI_Rn01_00174907 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109690 predicted 1160
2 SASI_Mm01_00109691 predicted 518
3 SASI_Mm01_00109692 predicted 418
4 SASI_Mm01_00109693 predicted 1437
5 SASI_Mm01_00109694 predicted 1481
6 SASI_Mm01_00109695 predicted 1444
7 SASI_Mm01_00109696 predicted 573
8 SASI_Mm01_00109697 predicted 1267
9 SASI_Mm01_00109698 predicted 999
10 SASI_Mm01_00109699 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183193
FOXI2 MISSION shRNA Bacterial Glycerol Stock
forkhead box I2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183193.1-1809s1c1
Sequence:CCGGCCTGAGAACTTCCTCCAGAATCTCGAGATTCTGGAGGAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-275s1c1
Sequence:CCGGCGGGTTCGCTTCTTGGCGCTTCTCGAGAAGCGCCAAGAAGCGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-525s1c1
Sequence:CCGGGTCGCTCAATGATTGCTTCAACTCGAGTTGAAGCAATCATTGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-986s1c1
Sequence:CCGGGCCGGGATGGGACTGAAGTTTCTCGAGAAACTTCAGTCCCATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-557s1c1
Sequence:CCGGGAGATGAGAACGATCCAGGAACTCGAGTTCCTGGATCGTTCTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183193
FOXI2 MISSION shRNA shRNA Plasmid DNA
forkhead box I2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183193.1-1809s1c1
Sequence:CCGGCCTGAGAACTTCCTCCAGAATCTCGAGATTCTGGAGGAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-275s1c1
Sequence:CCGGCGGGTTCGCTTCTTGGCGCTTCTCGAGAAGCGCCAAGAAGCGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-525s1c1
Sequence:CCGGGTCGCTCAATGATTGCTTCAACTCGAGTTGAAGCAATCATTGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-986s1c1
Sequence:CCGGGCCGGGATGGGACTGAAGTTTCTCGAGAAACTTCAGTCCCATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-557s1c1
Sequence:CCGGGAGATGAGAACGATCCAGGAACTCGAGTTCCTGGATCGTTCTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183193
FOXI2 MISSION shRNA Lentiviral Transduction Particles
forkhead box I2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183193.1-1809s1c1
Sequence:CCGGCCTGAGAACTTCCTCCAGAATCTCGAGATTCTGGAGGAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-275s1c1
Sequence:CCGGCGGGTTCGCTTCTTGGCGCTTCTCGAGAAGCGCCAAGAAGCGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-525s1c1
Sequence:CCGGGTCGCTCAATGATTGCTTCAACTCGAGTTGAAGCAATCATTGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-986s1c1
Sequence:CCGGGCCGGGATGGGACTGAAGTTTCTCGAGAAACTTCAGTCCCATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183193.1-557s1c1
Sequence:CCGGGAGATGAGAACGATCCAGGAACTCGAGTTCCTGGATCGTTCTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374844
FOXI2 MISSION shRNA Bacterial Glycerol Stock
forkhead box I2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000016423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-504s1c1
Sequence:CCGGCGACCCAGGTAAAGGCAATTACTCGAGTAATTGCCTTTACCTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-561s1c1
Sequence:CCGGCAACGGGAACTTCCGAAGGAACTCGAGTTCCTTCGGAAGTTCCCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-399s1c1
Sequence:CCGGTGGTAACTTCCCTTTCTACAACTCGAGTTGTAGAAAGGGAAGTTACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-723s1c1
Sequence:CCGGCGCCACCTGCTTCTCCGGTTTCTCGAGAAACCGGAGAAGCAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374844
FOXI2 MISSION shRNA shRNA Plasmid DNA
forkhead box I2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000016423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-504s1c1
Sequence:CCGGCGACCCAGGTAAAGGCAATTACTCGAGTAATTGCCTTTACCTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-561s1c1
Sequence:CCGGCAACGGGAACTTCCGAAGGAACTCGAGTTCCTTCGGAAGTTCCCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-399s1c1
Sequence:CCGGTGGTAACTTCCCTTTCTACAACTCGAGTTGTAGAAAGGGAAGTTACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-723s1c1
Sequence:CCGGCGCCACCTGCTTCTCCGGTTTCTCGAGAAACCGGAGAAGCAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374844
FOXI2 MISSION shRNA Lentiviral Transduction Particles
forkhead box I2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000016423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-504s1c1
Sequence:CCGGCGACCCAGGTAAAGGCAATTACTCGAGTAATTGCCTTTACCTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-561s1c1
Sequence:CCGGCAACGGGAACTTCCGAAGGAACTCGAGTTCCTTCGGAAGTTCCCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-399s1c1
Sequence:CCGGTGGTAACTTCCCTTTCTACAACTCGAGTTGTAGAAAGGGAAGTTACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374844.1-723s1c1
Sequence:CCGGCGCCACCTGCTTCTCCGGTTTCTCGAGAAACCGGAGAAGCAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207426
FOXI2 MISSION shRNA Bacterial Glycerol Stock
forkhead box I2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000445378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207426.2-1317s21c1
Sequence:CCGGCCTTAGAGCAGATGGGAAGAACTCGAGTTCTTCCCATCTGCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207426.2-1220s21c1
Sequence:CCGGGTCTAGAACCTGTGCTCTCGACTCGAGTCGAGAGCACAGGTTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207426.2-363s21c1
Sequence:CCGGGAAGCTGACGCTCAGCCAGATCTCGAGATCTGGCTGAGCGTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207426.2-387s21c1
Sequence:CCGGCCAGTACGTGGCTGGTAACTTCTCGAGAAGTTACCAGCCACGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207426
FOXI2 MISSION shRNA shRNA Plasmid DNA
forkhead box I2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000445378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207426.2-1317s21c1
Sequence:CCGGCCTTAGAGCAGATGGGAAGAACTCGAGTTCTTCCCATCTGCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207426.2-1220s21c1
Sequence:CCGGGTCTAGAACCTGTGCTCTCGACTCGAGTCGAGAGCACAGGTTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207426.2-363s21c1
Sequence:CCGGGAAGCTGACGCTCAGCCAGATCTCGAGATCTGGCTGAGCGTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207426.2-387s21c1
Sequence:CCGGCCAGTACGTGGCTGGTAACTTCTCGAGAAGTTACCAGCCACGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207426
FOXI2 MISSION shRNA Lentiviral Transduction Particles
forkhead box I2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000445378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207426.2-1317s21c1
Sequence:CCGGCCTTAGAGCAGATGGGAAGAACTCGAGTTCTTCCCATCTGCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207426.2-1220s21c1
Sequence:CCGGGTCTAGAACCTGTGCTCTCGACTCGAGTCGAGAGCACAGGTTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207426.2-363s21c1
Sequence:CCGGGAAGCTGACGCTCAGCCAGATCTCGAGATCTGGCTGAGCGTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207426.2-387s21c1
Sequence:CCGGCCAGTACGTGGCTGGTAACTTCTCGAGAAGTTACCAGCCACGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks