EMAIL THIS PAGE TO A FRIEND

FOXI3

forkhead box I3

78 Gene Product Result for
UniProtKB ID: A8MTJ6, B5RI09
Gene ID:
Mouse(232077) forkhead box I3
Rat(502846) forkhead box I3
sheep(101104229) forkhead box I3
naked mole-rat(101714262) forkhead box I3
chicken(428801) forkhead box I3
domestic cat(101099039) forkhead box I3
cow(787272) forkhead box I3
dog(483075) forkhead box I3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001135649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_292958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292958 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_144880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_144880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_144880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001126001 Rosetta Predictions human pricing
XM_001713929 Rosetta Predictions human pricing
XM_001719143 Rosetta Predictions human pricing
XM_292958 Rosetta Predictions human pricing
NM_001109349 Rosetta Predictions rat pricing
XM_144880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00382298 predicted 753
2 SASI_Hs02_00382299 predicted 799
3 SASI_Hs02_00382300 predicted 743
4 SASI_Hs02_00382301 predicted 1236
5 SASI_Hs02_00382302 predicted 750
6 SASI_Hs02_00382303 predicted 874
7 SASI_Hs02_00382304 predicted 1184
8 SASI_Hs02_00382305 predicted 859
9 SASI_Hs02_00382306 predicted 1302
10 SASI_Hs02_00382307 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393866 predicted 530
2 SASI_Hs02_00393867 predicted 543
3 SASI_Hs02_00393868 predicted 1637
4 SASI_Hs02_00393869 predicted 1421
5 SASI_Hs02_00393870 predicted 1427
6 SASI_Hs02_00393871 predicted 1249
7 SASI_Hs02_00393872 predicted 1332
8 SASI_Hs02_00393873 predicted 1450
9 SASI_Hs02_00393874 predicted 1306
10 SASI_Hs02_00393875 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00428488 predicted 1523
2 SASI_Hs02_00428489 predicted 1576
3 SASI_Hs02_00428490 predicted 1633
4 SASI_Hs02_00428491 predicted 1486
5 SASI_Hs02_00428492 predicted 1488
6 SASI_Hs02_00428493 predicted 1613
7 SASI_Hs02_00428494 predicted 1619
8 SASI_Hs02_00428495 predicted 1431
9 SASI_Hs02_00428496 predicted 1525
10 SASI_Hs02_00428497 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255639 predicted 159
2 SASI_Hs01_00255640 predicted 714
3 SASI_Hs01_00255641 predicted 765
4 SASI_Hs01_00255642 predicted 1201
5 SASI_Hs01_00255643 predicted 119
6 SASI_Hs01_00255644 predicted 815
7 SASI_Hs01_00255645 predicted 174
8 SASI_Hs01_00255646 predicted 92
9 SASI_Hs01_00255647 predicted 838
10 SASI_Hs01_00255648 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247554 predicted 696
2 SASI_Rn02_00247555 predicted 896
3 SASI_Rn02_00247556 predicted 868
4 SASI_Rn02_00247557 predicted 599
5 SASI_Rn02_00247558 predicted 876
6 SASI_Rn02_00247559 predicted 479
7 SASI_Rn02_00247560 predicted 751
8 SASI_Rn02_00247561 predicted 744
9 SASI_Rn02_00247562 predicted 854
10 SASI_Rn02_00247563 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269005 predicted 194
2 SASI_Mm02_00425258 predicted 586
3 SASI_Mm02_00425259 predicted 857
4 SASI_Mm02_00425260 predicted 708
5 SASI_Mm02_00425261 predicted 586
6 SASI_Mm02_00425262 predicted 820
7 SASI_Mm02_00425263 predicted 849
8 SASI_Mm02_00425264 predicted 711
9 SASI_Mm02_00425265 predicted 576
10 SASI_Mm02_00425266 predicted 582
11 SASI_Mm01_00269004 predicted 1016
12 SASI_Mm01_00269006 predicted 1010
13 SASI_Mm01_00269007 predicted 1047
14 SASI_Mm01_00269008 predicted 230
15 SASI_Mm01_00269009 predicted 935
16 SASI_Mm01_00269010 predicted 1017
17 SASI_Mm01_00269011 predicted 219
18 SASI_Mm01_00269012 predicted 356
19 SASI_Mm01_00269013 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135649
FOXI3 MISSION shRNA Bacterial Glycerol Stock
forkhead box I3
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000443722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135649.1-758s21c1
Sequence:CCGGGGACATCAAAGTCCGAAGAAGCTCGAGCTTCTTCGGACTTTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135649.1-1129s21c1
Sequence:CCGGGGCCAGAGATCTTCCTATTACCTCGAGGTAATAGGAAGATCTCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135649
FOXI3 MISSION shRNA shRNA Plasmid DNA
forkhead box I3
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000443722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135649.1-758s21c1
Sequence:CCGGGGACATCAAAGTCCGAAGAAGCTCGAGCTTCTTCGGACTTTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135649.1-1129s21c1
Sequence:CCGGGGCCAGAGATCTTCCTATTACCTCGAGGTAATAGGAAGATCTCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135649
FOXI3 MISSION shRNA Lentiviral Transduction Particles
forkhead box I3
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000443722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135649.1-758s21c1
Sequence:CCGGGGACATCAAAGTCCGAAGAAGCTCGAGCTTCTTCGGACTTTGATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135649.1-1129s21c1
Sequence:CCGGGGCCAGAGATCTTCCTATTACCTCGAGGTAATAGGAAGATCTCTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101464
FOXI3 MISSION shRNA Bacterial Glycerol Stock
forkhead box I3
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000244573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101464.1-729s21c1
Sequence:CCGGAGGGCAGTCCTCAAGACTAAGCTCGAGCTTAGTCTTGAGGACTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101464.1-478s21c1
Sequence:CCGGGTCGCCGATAACTTCCCTTTCCTCGAGGAAAGGGAAGTTATCGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101464
FOXI3 MISSION shRNA shRNA Plasmid DNA
forkhead box I3
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000244573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101464.1-729s21c1
Sequence:CCGGAGGGCAGTCCTCAAGACTAAGCTCGAGCTTAGTCTTGAGGACTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101464.1-478s21c1
Sequence:CCGGGTCGCCGATAACTTCCCTTTCCTCGAGGAAAGGGAAGTTATCGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101464
FOXI3 MISSION shRNA Lentiviral Transduction Particles
forkhead box I3
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000244573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101464.1-729s21c1
Sequence:CCGGAGGGCAGTCCTCAAGACTAAGCTCGAGCTTAGTCTTGAGGACTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101464.1-478s21c1
Sequence:CCGGGTCGCCGATAACTTCCCTTTCCTCGAGGAAAGGGAAGTTATCGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292958
FOXI3 MISSION shRNA Bacterial Glycerol Stock
forkhead box I3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000017823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-75s1c1
Sequence:CCGGCGGGCCTGTTAATAACCTCTACTCGAGTAGAGGTTATTAACAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-110s1c1
Sequence:CCGGGCGTTGTAAATCACATCGATTCTCGAGAATCGATGTGATTTACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-28s1c1
Sequence:CCGGCCACGAACACTAGACTCGAATCTCGAGATTCGAGTCTAGTGTTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-441s1c1
Sequence:CCGGCGACCCAGGAAAGGGTAATTACTCGAGTAATTACCCTTTCCTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292958
FOXI3 MISSION shRNA shRNA Plasmid DNA
forkhead box I3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000017823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-75s1c1
Sequence:CCGGCGGGCCTGTTAATAACCTCTACTCGAGTAGAGGTTATTAACAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-110s1c1
Sequence:CCGGGCGTTGTAAATCACATCGATTCTCGAGAATCGATGTGATTTACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-28s1c1
Sequence:CCGGCCACGAACACTAGACTCGAATCTCGAGATTCGAGTCTAGTGTTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-441s1c1
Sequence:CCGGCGACCCAGGAAAGGGTAATTACTCGAGTAATTACCCTTTCCTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292958
FOXI3 MISSION shRNA Lentiviral Transduction Particles
forkhead box I3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000017823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-75s1c1
Sequence:CCGGCGGGCCTGTTAATAACCTCTACTCGAGTAGAGGTTATTAACAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-110s1c1
Sequence:CCGGGCGTTGTAAATCACATCGATTCTCGAGAATCGATGTGATTTACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-28s1c1
Sequence:CCGGCCACGAACACTAGACTCGAATCTCGAGATTCGAGTCTAGTGTTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292958.3-441s1c1
Sequence:CCGGCGACCCAGGAAAGGGTAATTACTCGAGTAATTACCCTTTCCTGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_144880
FOXI3 MISSION shRNA Bacterial Glycerol Stock
forkhead box I3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-914s1c1
Sequence:CCGGGCAGTAACCTTACTGTGCCTTCTCGAGAAGGCACAGTAAGGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-624s1c1
Sequence:CCGGCGTCGCCGATAACTTCCCTTTCTCGAGAAAGGGAAGTTATCGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-1095s1c1
Sequence:CCGGCACTCCGTGTCTCAACACTTTCTCGAGAAAGTGTTGAGACACGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-603s1c1
Sequence:CCGGCCTCAGCCACATTTACCAGTTCTCGAGAACTGGTAAATGTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-1119s1c1
Sequence:CCGGCAGCACCTTTAACACCTTAAACTCGAGTTTAAGGTGTTAAAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_144880
FOXI3 MISSION shRNA shRNA Plasmid DNA
forkhead box I3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-914s1c1
Sequence:CCGGGCAGTAACCTTACTGTGCCTTCTCGAGAAGGCACAGTAAGGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-624s1c1
Sequence:CCGGCGTCGCCGATAACTTCCCTTTCTCGAGAAAGGGAAGTTATCGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-1095s1c1
Sequence:CCGGCACTCCGTGTCTCAACACTTTCTCGAGAAAGTGTTGAGACACGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-603s1c1
Sequence:CCGGCCTCAGCCACATTTACCAGTTCTCGAGAACTGGTAAATGTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-1119s1c1
Sequence:CCGGCAGCACCTTTAACACCTTAAACTCGAGTTTAAGGTGTTAAAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_144880
FOXI3 MISSION shRNA Lentiviral Transduction Particles
forkhead box I3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-914s1c1
Sequence:CCGGGCAGTAACCTTACTGTGCCTTCTCGAGAAGGCACAGTAAGGTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-624s1c1
Sequence:CCGGCGTCGCCGATAACTTCCCTTTCTCGAGAAAGGGAAGTTATCGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-1095s1c1
Sequence:CCGGCACTCCGTGTCTCAACACTTTCTCGAGAAAGTGTTGAGACACGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-603s1c1
Sequence:CCGGCCTCAGCCACATTTACCAGTTCTCGAGAACTGGTAAATGTGGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144880.2-1119s1c1
Sequence:CCGGCAGCACCTTTAACACCTTAAACTCGAGTTTAAGGTGTTAAAGGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks