EMAIL THIS PAGE TO A FRIEND

FOXJ1

forkhead box J1

68 Gene Product Result for
Synonyms: FKHL13 HFH-4 HFH4
UniProtKB ID: Q92949, O00630
Gene ID:
Human(2302) Summary: This gene encodes a member of the forkhead family of transcription factors. Similar genes in zebrafish and mouse have been shown to regulate the transcription of genes that control the production of motile cilia. The mouse ortholog also functions in the determination of left-right asymmetry. Polymorphisms in this gene are associated with systemic lupus erythematosus and allergic rhinitis.[provided by RefSeq, Sep 2009]
Mouse(15223) forkhead box J1
Rat(116557) forkhead box J1
chicken(770009) forkhead box J1
domestic cat(101084404) forkhead box J1
cow(505891) forkhead box J1
Horse(100147129) forkhead box J1
dog(475917) forkhead box J1
naked mole-rat(101708847) forkhead box J1
sheep(101117859) forkhead box J1
Domestic Rabbit(100008873) forkhead box J1
sheep(100303603) forkhead box J1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405817 Anti-FOXJ1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA005714 Anti-FOXJ1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV38038 Anti-FOXJ1 antibody produced in rabbit affinity isolated antibody rat, human, rabbit, bovine, guinea pig, horse, sheep, canine, mouse
immunohistochemistry, western blot pricing
SAB2100843 Anti-FOXJ1 antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, rabbit, rat, rabbit, horse, mouse
western blot pricing
SAB2105415 Anti-FOXJ1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, rabbit
western blot pricing
SAB2105259 Anti-FOXJ1 antibody produced in rabbit affinity isolated antibody rabbit, mouse, guinea pig, horse
western blot pricing
SAB4500928 Anti-FOXJ1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
WH0002302M1 Monoclonal Anti-FOXJ1 antibody produced in mouse clone 5B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91254 Monoclonal Anti-FOXJ1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3989, purified immunoglobulin New human
immunohistochemistry pricing
AMAB91255 Monoclonal Anti-FOXJ1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3991, purified immunoglobulin New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001454 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU054681 MISSION® esiRNA esiRNA targeting mouse Foxj1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001454 Rosetta Predictions human pricing
NM_053832 Rosetta Predictions rat pricing
NM_008240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092327 predicted 567
2 SASI_Hs01_00092328 predicted 570
3 SASI_Hs01_00092329 predicted 1578
4 SASI_Hs01_00092330 predicted 427
5 SASI_Hs01_00092331 predicted 471
6 SASI_Hs01_00092332 predicted 1765
7 SASI_Hs01_00092333 predicted 700
8 SASI_Hs01_00092334 predicted 1019
9 SASI_Hs01_00092335 predicted 695
10 SASI_Hs01_00092336 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044679 predicted 1081
2 SASI_Rn01_00044680 predicted 1747
3 SASI_Rn01_00044681 predicted 244
4 SASI_Rn01_00044682 predicted 1285
5 SASI_Rn01_00044683 predicted 1715
6 SASI_Rn01_00044685 predicted 1340
7 SASI_Rn01_00044686 predicted 255
8 SASI_Rn01_00044687 predicted 497
9 SASI_Rn02_00266668 predicted 1372
10 SASI_Rn02_00266669 predicted 763
11 SASI_Rn01_00044678 predicted 564
12 SASI_Rn01_00044684 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132072 predicted 800
2 SASI_Mm01_00132073 predicted 1309
3 SASI_Mm01_00132074 predicted 1351
4 SASI_Mm02_00313428 predicted 551
5 SASI_Mm01_00132075 predicted 1335
6 SASI_Mm01_00132076 predicted 1590
7 SASI_Mm01_00132077 predicted 566
8 SASI_Mm01_00132078 predicted 1337
9 SASI_Mm02_00313429 predicted 680
10 SASI_Mm01_00132079 predicted 812
11 SASI_Mm01_00132080 predicted 1445
12 SASI_Mm01_00132081 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008240
FOXJ1 MISSION shRNA Bacterial Glycerol Stock
forkhead box J1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008240.2-2002s1c1
Sequence:CCGGCGCTCATTAGATGATAACAAACTCGAGTTTGTTATCATCTAATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-413s1c1
Sequence:CCGGGCTGCAGGAATTCTCCATTCTCTCGAGAGAATGGAGAATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-1485s1c1
Sequence:CCGGCCAGAACCCATCTTTGAAGCACTCGAGTGCTTCAAAGATGGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-743s1c1
Sequence:CCGGCAAGTGGATCACGGACAACTTCTCGAGAAGTTGTCCGTGATCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-1206s1c1
Sequence:CCGGGAACCACTCAAAGGTAACTTTCTCGAGAAAGTTACCTTTGAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-1334s21c1
Sequence:CCGGATGTGGATCTTACAGTCCATGCTCGAGCATGGACTGTAAGATCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008240.3-1987s21c1
Sequence:CCGGGAAAGTTCCCAGGTACAACAACTCGAGTTGTTGTACCTGGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-728s21c1
Sequence:CCGGAGATCACTCTGTCGGCCATCTCTCGAGAGATGGCCGACAGAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008240.3-1812s21c1
Sequence:CCGGTCAAGCCCAAGGATTGGCAAACTCGAGTTTGCCAATCCTTGGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-1553s21c1
Sequence:CCGGGTGTGGGTGCCTTCTTGTAAACTCGAGTTTACAAGAAGGCACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008240
FOXJ1 MISSION shRNA shRNA Plasmid DNA
forkhead box J1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008240.2-2002s1c1
Sequence:CCGGCGCTCATTAGATGATAACAAACTCGAGTTTGTTATCATCTAATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-413s1c1
Sequence:CCGGGCTGCAGGAATTCTCCATTCTCTCGAGAGAATGGAGAATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-1485s1c1
Sequence:CCGGCCAGAACCCATCTTTGAAGCACTCGAGTGCTTCAAAGATGGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-743s1c1
Sequence:CCGGCAAGTGGATCACGGACAACTTCTCGAGAAGTTGTCCGTGATCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-1206s1c1
Sequence:CCGGGAACCACTCAAAGGTAACTTTCTCGAGAAAGTTACCTTTGAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-1334s21c1
Sequence:CCGGATGTGGATCTTACAGTCCATGCTCGAGCATGGACTGTAAGATCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008240.3-1987s21c1
Sequence:CCGGGAAAGTTCCCAGGTACAACAACTCGAGTTGTTGTACCTGGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-728s21c1
Sequence:CCGGAGATCACTCTGTCGGCCATCTCTCGAGAGATGGCCGACAGAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008240.3-1812s21c1
Sequence:CCGGTCAAGCCCAAGGATTGGCAAACTCGAGTTTGCCAATCCTTGGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-1553s21c1
Sequence:CCGGGTGTGGGTGCCTTCTTGTAAACTCGAGTTTACAAGAAGGCACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008240
FOXJ1 MISSION shRNA Lentiviral Transduction Particles
forkhead box J1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008240.2-2002s1c1
Sequence:CCGGCGCTCATTAGATGATAACAAACTCGAGTTTGTTATCATCTAATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-413s1c1
Sequence:CCGGGCTGCAGGAATTCTCCATTCTCTCGAGAGAATGGAGAATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-1485s1c1
Sequence:CCGGCCAGAACCCATCTTTGAAGCACTCGAGTGCTTCAAAGATGGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-743s1c1
Sequence:CCGGCAAGTGGATCACGGACAACTTCTCGAGAAGTTGTCCGTGATCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008240.2-1206s1c1
Sequence:CCGGGAACCACTCAAAGGTAACTTTCTCGAGAAAGTTACCTTTGAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-1334s21c1
Sequence:CCGGATGTGGATCTTACAGTCCATGCTCGAGCATGGACTGTAAGATCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008240.3-1987s21c1
Sequence:CCGGGAAAGTTCCCAGGTACAACAACTCGAGTTGTTGTACCTGGGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-728s21c1
Sequence:CCGGAGATCACTCTGTCGGCCATCTCTCGAGAGATGGCCGACAGAGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008240.3-1812s21c1
Sequence:CCGGTCAAGCCCAAGGATTGGCAAACTCGAGTTTGCCAATCCTTGGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008240.3-1553s21c1
Sequence:CCGGGTGTGGGTGCCTTCTTGTAAACTCGAGTTTACAAGAAGGCACCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001454
FOXJ1 MISSION shRNA Bacterial Glycerol Stock
forkhead box J1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001454.1-1889s1c1
Sequence:CCGGCCCAGGTACAACAAATGCTAACTCGAGTTAGCATTTGTTGTACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-666s1c1
Sequence:CCGGCACGGACAACTTCTGCTACTTCTCGAGAAGTAGCAGAAGTTGTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-1019s1c1
Sequence:CCGGGCTGGGACATAAGCCCAAACACTCGAGTGTTTGGGCTTATGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-555s1c1
Sequence:CCGGCGCCACCAATCCGCACGTGAACTCGAGTTCACGTGCGGATTGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-837s1c1
Sequence:CCGGCGCTTTCAAGAAGCGGCGACTCTCGAGAGTCGCCGCTTCTTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001454.3-1280s21c1
Sequence:CCGGTTTGACTGGGAGGCCATCTTCCTCGAGGAAGATGGCCTCCCAGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001454.3-726s21c1
Sequence:CCGGACTCGTATGCCACGCTCATCTCTCGAGAGATGAGCGTGGCATACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001454.3-1768s21c1
Sequence:CCGGCCCAGCTGCCATCAGATTCAACTCGAGTTGAATCTGATGGCAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001454
FOXJ1 MISSION shRNA shRNA Plasmid DNA
forkhead box J1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001454.1-1889s1c1
Sequence:CCGGCCCAGGTACAACAAATGCTAACTCGAGTTAGCATTTGTTGTACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-666s1c1
Sequence:CCGGCACGGACAACTTCTGCTACTTCTCGAGAAGTAGCAGAAGTTGTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-1019s1c1
Sequence:CCGGGCTGGGACATAAGCCCAAACACTCGAGTGTTTGGGCTTATGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-555s1c1
Sequence:CCGGCGCCACCAATCCGCACGTGAACTCGAGTTCACGTGCGGATTGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-837s1c1
Sequence:CCGGCGCTTTCAAGAAGCGGCGACTCTCGAGAGTCGCCGCTTCTTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001454.3-1280s21c1
Sequence:CCGGTTTGACTGGGAGGCCATCTTCCTCGAGGAAGATGGCCTCCCAGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001454.3-726s21c1
Sequence:CCGGACTCGTATGCCACGCTCATCTCTCGAGAGATGAGCGTGGCATACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001454.3-1768s21c1
Sequence:CCGGCCCAGCTGCCATCAGATTCAACTCGAGTTGAATCTGATGGCAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001454
FOXJ1 MISSION shRNA Lentiviral Transduction Particles
forkhead box J1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001454.1-1889s1c1
Sequence:CCGGCCCAGGTACAACAAATGCTAACTCGAGTTAGCATTTGTTGTACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-666s1c1
Sequence:CCGGCACGGACAACTTCTGCTACTTCTCGAGAAGTAGCAGAAGTTGTCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-1019s1c1
Sequence:CCGGGCTGGGACATAAGCCCAAACACTCGAGTGTTTGGGCTTATGTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-555s1c1
Sequence:CCGGCGCCACCAATCCGCACGTGAACTCGAGTTCACGTGCGGATTGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001454.1-837s1c1
Sequence:CCGGCGCTTTCAAGAAGCGGCGACTCTCGAGAGTCGCCGCTTCTTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001454.3-1280s21c1
Sequence:CCGGTTTGACTGGGAGGCCATCTTCCTCGAGGAAGATGGCCTCCCAGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001454.3-726s21c1
Sequence:CCGGACTCGTATGCCACGCTCATCTCTCGAGAGATGAGCGTGGCATACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001454.3-1768s21c1
Sequence:CCGGCCCAGCTGCCATCAGATTCAACTCGAGTTGAATCTGATGGCAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks