EMAIL THIS PAGE TO A FRIEND

FOXJ2

forkhead box J2

213 Gene Product Result for
Synonyms: FHX
UniProtKB ID: Q9P0K8, A0AVK4, B2RMP3, Q96PS9, Q9NSN5
Gene ID:
Mouse(60611) forkhead box J2
Rat(502886) forkhead box J2
Zebrafish(558490) forkhead box J2
domestic cat(101096490) forkhead box J2
cow(540703) forkhead box J2
Horse(100053321) forkhead box J2
dog(486703) forkhead box J2
chicken(418259) forkhead box J2
sheep(101123457) forkhead box J2
Domestic Rabbit(100345239) forkhead box J2
naked mole-rat(101709380) forkhead box J2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018416 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018416 Rosetta Predictions human pricing
NM_001109352 Rosetta Predictions rat pricing
NM_021899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036726 predicted 1348
2 SASI_Hs01_00036727 predicted 1488
3 SASI_Hs01_00036728 predicted 2795
4 SASI_Hs02_00351921 predicted 1398
5 SASI_Hs01_00036730 predicted 1547
6 SASI_Hs01_00036732 predicted 1439
7 SASI_Hs01_00036733 predicted 2326
8 SASI_Hs02_00351922 predicted 1225
9 SASI_Hs01_00036734 predicted 1408
10 SASI_Hs01_00036735 predicted 2761
11 SASI_Hs01_00036729 predicted 2622
12 SASI_Hs01_00036731 predicted 2384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247584 predicted 1248
2 SASI_Rn02_00247585 predicted 2329
3 SASI_Rn02_00247586 predicted 1103
4 SASI_Rn02_00247587 predicted 1337
5 SASI_Rn02_00247588 predicted 1132
6 SASI_Rn02_00247589 predicted 2048
7 SASI_Rn02_00247590 predicted 1126
8 SASI_Rn02_00247591 predicted 2608
9 SASI_Rn02_00247592 predicted 2488
10 SASI_Rn02_00247593 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160438 predicted 2604
2 SASI_Mm01_00160439 predicted 1637
3 SASI_Mm01_00160440 predicted 889
4 SASI_Mm01_00160441 predicted 769
5 SASI_Mm01_00160442 predicted 758
6 SASI_Mm01_00160443 predicted 2095
7 SASI_Mm01_00160444 predicted 2595
8 SASI_Mm01_00160445 predicted 784
9 SASI_Mm01_00160446 predicted 1939
10 SASI_Mm01_00160447 predicted 1958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018416
VALIDATED
FOXJ2 MISSION shRNA Bacterial Glycerol Stock
forkhead box J2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018416.2-2399s21c1
Sequence:CCGGGTCACAATTCTCAGAACTGATCTCGAGATCAGTTCTGAGAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018416.2-2896s21c1
Sequence:CCGGCCCGTCTGTATATAGACATATCTCGAGATATGTCTATATACAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018416.2-1850s21c1
Sequence:CCGGCCGCAACCTCTATAAGTCCATCTCGAGATGGACTTATAGAGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018416.2-1364s21c1
Sequence:CCGGCCGCTGGATCTGTGATAACTTCTCGAGAAGTTATCACAGATCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1850s1c1
Sequence:CCGGCCGCAACCTCTATAAGTCCATCTCGAGATGGACTTATAGAGGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1146s1c1
Sequence:CCGGCGAGCTACCATTGAGAAGCTTCTCGAGAAGCTTCTCAATGGTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-2399s1c1
Sequence:CCGGGTCACAATTCTCAGAACTGATCTCGAGATCAGTTCTGAGAATTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-2666s1c1
Sequence:CCGGCCCATCACCAATGTACCCAATCTCGAGATTGGGTACATTGGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1364s1c1
Sequence:CCGGCCGCTGGATCTGTGATAACTTCTCGAGAAGTTATCACAGATCCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018416
VALIDATED
FOXJ2 MISSION shRNA shRNA Plasmid DNA
forkhead box J2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018416.2-2399s21c1
Sequence:CCGGGTCACAATTCTCAGAACTGATCTCGAGATCAGTTCTGAGAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018416.2-2896s21c1
Sequence:CCGGCCCGTCTGTATATAGACATATCTCGAGATATGTCTATATACAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018416.2-1850s21c1
Sequence:CCGGCCGCAACCTCTATAAGTCCATCTCGAGATGGACTTATAGAGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018416.2-1364s21c1
Sequence:CCGGCCGCTGGATCTGTGATAACTTCTCGAGAAGTTATCACAGATCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1850s1c1
Sequence:CCGGCCGCAACCTCTATAAGTCCATCTCGAGATGGACTTATAGAGGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1146s1c1
Sequence:CCGGCGAGCTACCATTGAGAAGCTTCTCGAGAAGCTTCTCAATGGTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-2399s1c1
Sequence:CCGGGTCACAATTCTCAGAACTGATCTCGAGATCAGTTCTGAGAATTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-2666s1c1
Sequence:CCGGCCCATCACCAATGTACCCAATCTCGAGATTGGGTACATTGGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1364s1c1
Sequence:CCGGCCGCTGGATCTGTGATAACTTCTCGAGAAGTTATCACAGATCCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018416
VALIDATED
FOXJ2 MISSION shRNA Lentiviral Transduction Particles
forkhead box J2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018416.2-2399s21c1
Sequence:CCGGGTCACAATTCTCAGAACTGATCTCGAGATCAGTTCTGAGAATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018416.2-2896s21c1
Sequence:CCGGCCCGTCTGTATATAGACATATCTCGAGATATGTCTATATACAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018416.2-1850s21c1
Sequence:CCGGCCGCAACCTCTATAAGTCCATCTCGAGATGGACTTATAGAGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018416.2-1364s21c1
Sequence:CCGGCCGCTGGATCTGTGATAACTTCTCGAGAAGTTATCACAGATCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1850s1c1
Sequence:CCGGCCGCAACCTCTATAAGTCCATCTCGAGATGGACTTATAGAGGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1146s1c1
Sequence:CCGGCGAGCTACCATTGAGAAGCTTCTCGAGAAGCTTCTCAATGGTAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-2399s1c1
Sequence:CCGGGTCACAATTCTCAGAACTGATCTCGAGATCAGTTCTGAGAATTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-2666s1c1
Sequence:CCGGCCCATCACCAATGTACCCAATCTCGAGATTGGGTACATTGGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018416.2-1364s1c1
Sequence:CCGGCCGCTGGATCTGTGATAACTTCTCGAGAAGTTATCACAGATCCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021899
VALIDATED
FOXJ2 MISSION shRNA Bacterial Glycerol Stock
forkhead box J2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1925s21c1
Sequence:CCGGGCCATCCATGAACCAAGTGAACTCGAGTTCACTTGGTTCATGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-782s21c1
Sequence:CCGGCCTTTCCCTTAACAAGTGTTTCTCGAGAAACACTTGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1139s21c1
Sequence:CCGGCCATGACTTCAAATTCTCCTACTCGAGTAGGAGAATTTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1271s21c1
Sequence:CCGGGCCACCTTCTAACAACTACTACTCGAGTAGTAGTTGTTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021899.2-4504s1c1
Sequence:CCGGCCACCCATAATGCTTTGCATTCTCGAGAATGCAAAGCATTATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-782s1c1
Sequence:CCGGCCTTTCCCTTAACAAGTGTTTCTCGAGAAACACTTGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1139s1c1
Sequence:CCGGCCATGACTTCAAATTCTCCTACTCGAGTAGGAGAATTTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1925s1c1
Sequence:CCGGGCCATCCATGAACCAAGTGAACTCGAGTTCACTTGGTTCATGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1271s1c1
Sequence:CCGGGCCACCTTCTAACAACTACTACTCGAGTAGTAGTTGTTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021899
VALIDATED
FOXJ2 MISSION shRNA shRNA Plasmid DNA
forkhead box J2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1925s21c1
Sequence:CCGGGCCATCCATGAACCAAGTGAACTCGAGTTCACTTGGTTCATGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-782s21c1
Sequence:CCGGCCTTTCCCTTAACAAGTGTTTCTCGAGAAACACTTGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1139s21c1
Sequence:CCGGCCATGACTTCAAATTCTCCTACTCGAGTAGGAGAATTTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1271s21c1
Sequence:CCGGGCCACCTTCTAACAACTACTACTCGAGTAGTAGTTGTTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021899.2-4504s1c1
Sequence:CCGGCCACCCATAATGCTTTGCATTCTCGAGAATGCAAAGCATTATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-782s1c1
Sequence:CCGGCCTTTCCCTTAACAAGTGTTTCTCGAGAAACACTTGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1139s1c1
Sequence:CCGGCCATGACTTCAAATTCTCCTACTCGAGTAGGAGAATTTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1925s1c1
Sequence:CCGGGCCATCCATGAACCAAGTGAACTCGAGTTCACTTGGTTCATGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1271s1c1
Sequence:CCGGGCCACCTTCTAACAACTACTACTCGAGTAGTAGTTGTTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021899
VALIDATED
FOXJ2 MISSION shRNA Lentiviral Transduction Particles
forkhead box J2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1925s21c1
Sequence:CCGGGCCATCCATGAACCAAGTGAACTCGAGTTCACTTGGTTCATGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-782s21c1
Sequence:CCGGCCTTTCCCTTAACAAGTGTTTCTCGAGAAACACTTGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1139s21c1
Sequence:CCGGCCATGACTTCAAATTCTCCTACTCGAGTAGGAGAATTTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021899.2-1271s21c1
Sequence:CCGGGCCACCTTCTAACAACTACTACTCGAGTAGTAGTTGTTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021899.2-4504s1c1
Sequence:CCGGCCACCCATAATGCTTTGCATTCTCGAGAATGCAAAGCATTATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-782s1c1
Sequence:CCGGCCTTTCCCTTAACAAGTGTTTCTCGAGAAACACTTGTTAAGGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1139s1c1
Sequence:CCGGCCATGACTTCAAATTCTCCTACTCGAGTAGGAGAATTTGAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1925s1c1
Sequence:CCGGGCCATCCATGAACCAAGTGAACTCGAGTTCACTTGGTTCATGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021899.2-1271s1c1
Sequence:CCGGGCCACCTTCTAACAACTACTACTCGAGTAGTAGTTGTTAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks