EMAIL THIS PAGE TO A FRIEND

FOXJ3

forkhead box J3

UniProtKB ID: Q9UPW0, A7MBL7, A7MD18, D3DPW2, Q9NSS7
Gene ID:
Mouse(230700) forkhead box J3
Rat(313554) forkhead box J3
naked mole-rat(101721372) forkhead box J3
sheep(101104696) forkhead box J3
Zebrafish(797147) forkhead box J3
cow(539458) forkhead box J3
Horse(100053693) forkhead box J3
domestic cat(101092871) forkhead box J3
dog(475310) forkhead box J3
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100844 Anti-FOXJ3 (ab1) antibody produced in rabbit affinity isolated antibody human, horse, bovine, canine, mouse, rat, rabbit, guinea pig
western blot pricing
SAB2100845 Anti-FOXJ3 (ab2) antibody produced in rabbit affinity isolated antibody horse, rat, human, mouse, bovine, rabbit, canine, guinea pig
western blot pricing
SAB4500907 Anti-FOXJ3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB2106236 Anti-FOXJ3 antibody produced in rabbit affinity isolated antibody horse, human, mouse, rabbit
ELISA, western blot pricing
HPA067284 Anti-FOXJ3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_378181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014947 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101201 MISSION® esiRNA esiRNA human FOXJ3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014947 Rosetta Predictions human pricing
NM_001107971 Rosetta Predictions rat pricing
NM_172699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227549 predicted 516
2 SASI_Hs01_00227550 predicted 557
3 SASI_Hs01_00227551 predicted 916
4 SASI_Hs01_00227552 predicted 552
5 SASI_Hs01_00227553 predicted 590
6 SASI_Hs01_00227554 predicted 836
7 SASI_Hs01_00227555 predicted 647
8 SASI_Hs01_00227556 predicted 757
9 SASI_Hs02_00346621 predicted 1111
10 SASI_Hs01_00227557 predicted 1838
11 SASI_Hs01_00227558 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234095 predicted 1622
2 SASI_Rn02_00234096 predicted 1146
3 SASI_Rn02_00234097 predicted 2145
4 SASI_Rn02_00234098 predicted 555
5 SASI_Rn02_00234099 predicted 389
6 SASI_Rn02_00234100 predicted 527
7 SASI_Rn02_00234101 predicted 1681
8 SASI_Rn02_00234102 predicted 308
9 SASI_Rn02_00234103 predicted 1582
10 SASI_Rn02_00234104 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189544 predicted 2126
2 SASI_Mm01_00189545 predicted 2097
3 SASI_Mm01_00189546 predicted 1097
4 SASI_Mm01_00189548 predicted 619
5 SASI_Mm01_00189549 predicted 1749
6 SASI_Mm01_00189550 predicted 2025
7 SASI_Mm01_00189551 predicted 468
8 SASI_Mm01_00189552 predicted 1915
9 SASI_Mm01_00189553 predicted 1638
10 SASI_Mm02_00344450 predicted 538
11 SASI_Mm01_00189547 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172699
VALIDATED
FOXJ3 MISSION shRNA Bacterial Glycerol Stock
forkhead box J3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172699.2-2590s1c1
Sequence:CCGGCCACCGAGTAAGTCAAAGAATCTCGAGATTCTTTGACTTACTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-1505s1c1
Sequence:CCGGCCGCAACAGGTATCCTGTAATCTCGAGATTACAGGATACCTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-490s1c1
Sequence:CCGGCCAATGGATTTGTGATAACTTCTCGAGAAGTTATCACAAATCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-992s1c1
Sequence:CCGGCCACAGTACAACCTTCCAGAACTCGAGTTCTGGAAGGTTGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172699.2-1564s1c1
Sequence:CCGGGCTGAAGGAAAGCTGTCGAATCTCGAGATTCGACAGCTTTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-910s21c1
Sequence:CCGGTGGAAGTGTACATAGTTATACCTCGAGGTATAACTATGTACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-992s21c1
Sequence:CCGGCCACAGTACAACCTTCCAGAACTCGAGTTCTGGAAGGTTGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172699.2-2132s21c1
Sequence:CCGGATGTTACCAGTGCTATCTAAACTCGAGTTTAGATAGCACTGGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-700s21c1
Sequence:CCGGACGGGCCTCAACTCCATATAGCTCGAGCTATATGGAGTTGAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-315s21c1
Sequence:CCGGATGCACATGGAACGGGAATTTCTCGAGAAATTCCCGTTCCATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172699
VALIDATED
FOXJ3 MISSION shRNA shRNA Plasmid DNA
forkhead box J3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172699.2-2590s1c1
Sequence:CCGGCCACCGAGTAAGTCAAAGAATCTCGAGATTCTTTGACTTACTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-1505s1c1
Sequence:CCGGCCGCAACAGGTATCCTGTAATCTCGAGATTACAGGATACCTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-490s1c1
Sequence:CCGGCCAATGGATTTGTGATAACTTCTCGAGAAGTTATCACAAATCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-992s1c1
Sequence:CCGGCCACAGTACAACCTTCCAGAACTCGAGTTCTGGAAGGTTGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172699.2-1564s1c1
Sequence:CCGGGCTGAAGGAAAGCTGTCGAATCTCGAGATTCGACAGCTTTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-910s21c1
Sequence:CCGGTGGAAGTGTACATAGTTATACCTCGAGGTATAACTATGTACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-992s21c1
Sequence:CCGGCCACAGTACAACCTTCCAGAACTCGAGTTCTGGAAGGTTGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172699.2-2132s21c1
Sequence:CCGGATGTTACCAGTGCTATCTAAACTCGAGTTTAGATAGCACTGGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-700s21c1
Sequence:CCGGACGGGCCTCAACTCCATATAGCTCGAGCTATATGGAGTTGAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-315s21c1
Sequence:CCGGATGCACATGGAACGGGAATTTCTCGAGAAATTCCCGTTCCATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172699
VALIDATED
FOXJ3 MISSION shRNA Lentiviral Transduction Particles
forkhead box J3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172699.2-2590s1c1
Sequence:CCGGCCACCGAGTAAGTCAAAGAATCTCGAGATTCTTTGACTTACTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-1505s1c1
Sequence:CCGGCCGCAACAGGTATCCTGTAATCTCGAGATTACAGGATACCTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-490s1c1
Sequence:CCGGCCAATGGATTTGTGATAACTTCTCGAGAAGTTATCACAAATCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172699.2-992s1c1
Sequence:CCGGCCACAGTACAACCTTCCAGAACTCGAGTTCTGGAAGGTTGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172699.2-1564s1c1
Sequence:CCGGGCTGAAGGAAAGCTGTCGAATCTCGAGATTCGACAGCTTTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-910s21c1
Sequence:CCGGTGGAAGTGTACATAGTTATACCTCGAGGTATAACTATGTACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-992s21c1
Sequence:CCGGCCACAGTACAACCTTCCAGAACTCGAGTTCTGGAAGGTTGTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172699.2-2132s21c1
Sequence:CCGGATGTTACCAGTGCTATCTAAACTCGAGTTTAGATAGCACTGGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-700s21c1
Sequence:CCGGACGGGCCTCAACTCCATATAGCTCGAGCTATATGGAGTTGAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172699.2-315s21c1
Sequence:CCGGATGCACATGGAACGGGAATTTCTCGAGAAATTCCCGTTCCATGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378181
VALIDATED
FOXJ3 MISSION shRNA Bacterial Glycerol Stock
forkhead box J3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000020799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378181.1-987s1c1
Sequence:CCGGGCCTTATACATTCACAGAGTACTCGAGTACTCTGTGAATGTATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-1265s1c1
Sequence:CCGGCAGGATGACTTTGATTGGGATCTCGAGATCCCAATCAAAGTCATCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-933s1c1
Sequence:CCGGAGGTTCAGTTTGCCGATCTTTCTCGAGAAAGATCGGCAAACTGAACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-1056s1c1
Sequence:CCGGCCCAACACATTGGAACAGGAACTCGAGTTCCTGTTCCAATGTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378181
VALIDATED
FOXJ3 MISSION shRNA shRNA Plasmid DNA
forkhead box J3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000020799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378181.1-987s1c1
Sequence:CCGGGCCTTATACATTCACAGAGTACTCGAGTACTCTGTGAATGTATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-1265s1c1
Sequence:CCGGCAGGATGACTTTGATTGGGATCTCGAGATCCCAATCAAAGTCATCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-933s1c1
Sequence:CCGGAGGTTCAGTTTGCCGATCTTTCTCGAGAAAGATCGGCAAACTGAACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-1056s1c1
Sequence:CCGGCCCAACACATTGGAACAGGAACTCGAGTTCCTGTTCCAATGTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378181
VALIDATED
FOXJ3 MISSION shRNA Lentiviral Transduction Particles
forkhead box J3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000020799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378181.1-987s1c1
Sequence:CCGGGCCTTATACATTCACAGAGTACTCGAGTACTCTGTGAATGTATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-1265s1c1
Sequence:CCGGCAGGATGACTTTGATTGGGATCTCGAGATCCCAATCAAAGTCATCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-933s1c1
Sequence:CCGGAGGTTCAGTTTGCCGATCTTTCTCGAGAAAGATCGGCAAACTGAACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:XM_378181.1-1056s1c1
Sequence:CCGGCCCAACACATTGGAACAGGAACTCGAGTTCCTGTTCCAATGTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014947
VALIDATED
FOXJ3 MISSION shRNA Bacterial Glycerol Stock
forkhead box J3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-1562s21c1
Sequence:CCGGTGCGACACTTGATATGCTAAACTCGAGTTTAGCATATCAAGTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-2144s21c1
Sequence:CCGGACAAACTTGCTAATCACTTTACTCGAGTAAAGTGATTAGCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014947.3-517s21c1
Sequence:CCGGGTGATAACTTCCCATATTATACTCGAGTATAATATGGGAAGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014947.3-716s21c1
Sequence:CCGGACGGGCCTCAACTCCATATAGCTCGAGCTATATGGAGTTGAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-966s21c1
Sequence:CCGGGAATCAGTCTCTCAATCATTACTCGAGTAATGATTGAGAGACTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-926s21c1
Sequence:CCGGTGGAAGTGTGCATAGTTATACCTCGAGGTATAACTATGCACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014947
VALIDATED
FOXJ3 MISSION shRNA shRNA Plasmid DNA
forkhead box J3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-1562s21c1
Sequence:CCGGTGCGACACTTGATATGCTAAACTCGAGTTTAGCATATCAAGTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-2144s21c1
Sequence:CCGGACAAACTTGCTAATCACTTTACTCGAGTAAAGTGATTAGCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014947.3-517s21c1
Sequence:CCGGGTGATAACTTCCCATATTATACTCGAGTATAATATGGGAAGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014947.3-716s21c1
Sequence:CCGGACGGGCCTCAACTCCATATAGCTCGAGCTATATGGAGTTGAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-966s21c1
Sequence:CCGGGAATCAGTCTCTCAATCATTACTCGAGTAATGATTGAGAGACTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-926s21c1
Sequence:CCGGTGGAAGTGTGCATAGTTATACCTCGAGGTATAACTATGCACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014947
VALIDATED
FOXJ3 MISSION shRNA Lentiviral Transduction Particles
forkhead box J3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-1562s21c1
Sequence:CCGGTGCGACACTTGATATGCTAAACTCGAGTTTAGCATATCAAGTGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-2144s21c1
Sequence:CCGGACAAACTTGCTAATCACTTTACTCGAGTAAAGTGATTAGCAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014947.3-517s21c1
Sequence:CCGGGTGATAACTTCCCATATTATACTCGAGTATAATATGGGAAGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014947.3-716s21c1
Sequence:CCGGACGGGCCTCAACTCCATATAGCTCGAGCTATATGGAGTTGAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-966s21c1
Sequence:CCGGGAATCAGTCTCTCAATCATTACTCGAGTAATGATTGAGAGACTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014947.3-926s21c1
Sequence:CCGGTGGAAGTGTGCATAGTTATACCTCGAGGTATAACTATGCACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks