EMAIL THIS PAGE TO A FRIEND

FOXK1

forkhead box K1

91 Gene Product Result for
Synonyms: FOXK1L
UniProtKB ID: P85037
Gene ID:
Mouse(17425) forkhead box K1
Rat(304298) forkhead box K1
Zebrafish(334470) forkhead box K1
cow(781626) forkhead box K1
Horse(100060644) forkhead box K1
domestic cat(101094312) forkhead box K1
dog(489885) forkhead box K1
chicken(395463) forkhead box K1
sheep(101110295) forkhead box K1
naked mole-rat(101725347) forkhead box K1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037165 Rosetta Predictions human pricing
NM_001037219 Rosetta Predictions rat pricing
NM_010812 Rosetta Predictions mouse pricing
NM_199068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149055 predicted 1391
2 SASI_Hs01_00149056 predicted 2413
3 SASI_Hs01_00149058 predicted 1073
4 SASI_Hs01_00149059 predicted 2364
5 SASI_Hs01_00149060 predicted 2514
6 SASI_Hs01_00149062 predicted 1067
7 SASI_Hs01_00149063 predicted 1722
8 SASI_Hs01_00149064 predicted 1068
9 SASI_Hs02_00308230 predicted 1723
10 SASI_Hs02_00308231 predicted 934
11 SASI_Hs01_00149057 predicted 1052
12 SASI_Hs01_00149061 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204342 predicted 1514
2 SASI_Rn02_00204343 predicted 1574
3 SASI_Rn02_00204344 predicted 1039
4 SASI_Rn02_00204345 predicted 768
5 SASI_Rn02_00204346 predicted 998
6 SASI_Rn02_00204347 predicted 2241
7 SASI_Rn02_00204348 predicted 1863
8 SASI_Rn02_00204349 predicted 1289
9 SASI_Rn02_00204350 predicted 1721
10 SASI_Rn02_00204351 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032593 predicted 988
2 SASI_Mm01_00032594 predicted 1026
3 SASI_Mm01_00032595 predicted 788
4 SASI_Mm01_00032596 predicted 1001
5 SASI_Mm01_00032597 predicted 778
6 SASI_Mm01_00032598 predicted 743
7 SASI_Mm01_00032599 predicted 575
8 SASI_Mm01_00032600 predicted 570
9 SASI_Mm01_00032601 predicted 953
10 SASI_Mm01_00032602 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351347 predicted 1876
2 SASI_Mm02_00351348 predicted 1591
3 SASI_Mm01_00160371 predicted 998
4 SASI_Mm01_00160372 predicted 775
5 SASI_Mm02_00351349 predicted 2245
6 SASI_Mm02_00351350 predicted 1044
7 SASI_Mm02_00351351 predicted 1470
8 SASI_Mm01_00160376 predicted 950
9 SASI_Mm02_00351352 predicted 2202
10 SASI_Mm02_00351353 predicted 1691
11 SASI_Mm01_00160368 predicted 987
12 SASI_Mm01_00160369 predicted 1030
13 SASI_Mm01_00160370 predicted 789
14 SASI_Mm01_00160373 predicted 741
15 SASI_Mm01_00160374 predicted 578
16 SASI_Mm01_00160375 predicted 569
17 SASI_Mm01_00160377 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199068
FOXK1 MISSION shRNA Bacterial Glycerol Stock
forkhead box K1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000426775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-398s21c1
Sequence:CCGGTGGGCCTGTCGAGCTTCATTTCTCGAGAAATGAAGCTCGACAGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-1865s21c1
Sequence:CCGGAGCACGCTGTACCCACGAATACTCGAGTATTCGTGGGTACAGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-1699s21c1
Sequence:CCGGACCATAGCATTTGCCACAATCCTCGAGGATTGTGGCAAATGCTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199068
FOXK1 MISSION shRNA shRNA Plasmid DNA
forkhead box K1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000426775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-398s21c1
Sequence:CCGGTGGGCCTGTCGAGCTTCATTTCTCGAGAAATGAAGCTCGACAGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-1865s21c1
Sequence:CCGGAGCACGCTGTACCCACGAATACTCGAGTATTCGTGGGTACAGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-1699s21c1
Sequence:CCGGACCATAGCATTTGCCACAATCCTCGAGGATTGTGGCAAATGCTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199068
FOXK1 MISSION shRNA Lentiviral Transduction Particles
forkhead box K1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000426775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-398s21c1
Sequence:CCGGTGGGCCTGTCGAGCTTCATTTCTCGAGAAATGAAGCTCGACAGGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-1865s21c1
Sequence:CCGGAGCACGCTGTACCCACGAATACTCGAGTATTCGTGGGTACAGCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199068.2-1699s21c1
Sequence:CCGGACCATAGCATTTGCCACAATCCTCGAGGATTGTGGCAAATGCTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037165
VALIDATED
FOXK1 MISSION shRNA Bacterial Glycerol Stock
forkhead box K1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-597s1c1
Sequence:CCGGCCATCAAGATCCAGTTCACGTCTCGAGACGTGAACTGGATCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-802s1c1
Sequence:CCGGCAGTTACCGCTTTGTGCAGAACTCGAGTTCTGCACAAAGCGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-1715s1c1
Sequence:CCGGGAGAAACCCACCATTGCGTTTCTCGAGAAACGCAATGGTGGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-8837s1c1
Sequence:CCGGGCCCGGAGTATCAGAGAATATCTCGAGATATTCTCTGATACTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-610s1c1
Sequence:CCGGGTTCACGTCGCTCTATCACAACTCGAGTTGTGATAGAGCGACGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157597    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037165.1-4512s1c1
Sequence:CCGGGCCTCCTCAATACAAGCTGATCTCGAGATCAGCTTGTATTGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-1375s1c1
Sequence:CCGGCAAGTTAGCTTCTGTCCCAGACTCGAGTCTGGGACAGAAGCTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-616s1c1
Sequence:CCGGGTCGCTCTATCACAAAGAAGACTCGAGTCTTCTTTGTGATAGAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037165.1-5498s1c1
Sequence:CCGGGCTGGATAAATTGCCAGGTTTCTCGAGAAACCTGGCAATTTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-1091s1c1
Sequence:CCGGCGTTACTTTATCAAAGTCCCACTCGAGTGGGACTTTGATAAAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-7274s1c1
Sequence:CCGGGCTGCTATGAAGACAGGATTACTCGAGTAATCCTGTCTTCATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037165
VALIDATED
FOXK1 MISSION shRNA shRNA Plasmid DNA
forkhead box K1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-597s1c1
Sequence:CCGGCCATCAAGATCCAGTTCACGTCTCGAGACGTGAACTGGATCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-802s1c1
Sequence:CCGGCAGTTACCGCTTTGTGCAGAACTCGAGTTCTGCACAAAGCGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-1715s1c1
Sequence:CCGGGAGAAACCCACCATTGCGTTTCTCGAGAAACGCAATGGTGGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-8837s1c1
Sequence:CCGGGCCCGGAGTATCAGAGAATATCTCGAGATATTCTCTGATACTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-610s1c1
Sequence:CCGGGTTCACGTCGCTCTATCACAACTCGAGTTGTGATAGAGCGACGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157597    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037165.1-4512s1c1
Sequence:CCGGGCCTCCTCAATACAAGCTGATCTCGAGATCAGCTTGTATTGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-1375s1c1
Sequence:CCGGCAAGTTAGCTTCTGTCCCAGACTCGAGTCTGGGACAGAAGCTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-616s1c1
Sequence:CCGGGTCGCTCTATCACAAAGAAGACTCGAGTCTTCTTTGTGATAGAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037165.1-5498s1c1
Sequence:CCGGGCTGGATAAATTGCCAGGTTTCTCGAGAAACCTGGCAATTTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-1091s1c1
Sequence:CCGGCGTTACTTTATCAAAGTCCCACTCGAGTGGGACTTTGATAAAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-7274s1c1
Sequence:CCGGGCTGCTATGAAGACAGGATTACTCGAGTAATCCTGTCTTCATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037165
VALIDATED
FOXK1 MISSION shRNA Lentiviral Transduction Particles
forkhead box K1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-597s1c1
Sequence:CCGGCCATCAAGATCCAGTTCACGTCTCGAGACGTGAACTGGATCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-802s1c1
Sequence:CCGGCAGTTACCGCTTTGTGCAGAACTCGAGTTCTGCACAAAGCGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-1715s1c1
Sequence:CCGGGAGAAACCCACCATTGCGTTTCTCGAGAAACGCAATGGTGGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-8837s1c1
Sequence:CCGGGCCCGGAGTATCAGAGAATATCTCGAGATATTCTCTGATACTCCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-610s1c1
Sequence:CCGGGTTCACGTCGCTCTATCACAACTCGAGTTGTGATAGAGCGACGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157597    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037165.1-4512s1c1
Sequence:CCGGGCCTCCTCAATACAAGCTGATCTCGAGATCAGCTTGTATTGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-1375s1c1
Sequence:CCGGCAAGTTAGCTTCTGTCCCAGACTCGAGTCTGGGACAGAAGCTAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-616s1c1
Sequence:CCGGGTCGCTCTATCACAAAGAAGACTCGAGTCTTCTTTGTGATAGAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001037165.1-5498s1c1
Sequence:CCGGGCTGGATAAATTGCCAGGTTTCTCGAGAAACCTGGCAATTTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037165.1-1091s1c1
Sequence:CCGGCGTTACTTTATCAAAGTCCCACTCGAGTGGGACTTTGATAAAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001037165.1-7274s1c1
Sequence:CCGGGCTGCTATGAAGACAGGATTACTCGAGTAATCCTGTCTTCATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010812
VALIDATED
FOXK1 MISSION shRNA Bacterial Glycerol Stock
forkhead box K1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000085683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010812.1-1128s1c1
Sequence:CCGGCGTGGAACAAGCATTCCGAAACTCGAGTTTCGGAATGCTTGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010812.1-936s1c1
Sequence:CCGGGCTAACACTAAGTGGCATCTACTCGAGTAGATGCCACTTAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010812.1-555s1c1
Sequence:CCGGGATCCAGTTCACATCGCTATACTCGAGTATAGCGATGTGAACTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010812.1-1029s1c1
Sequence:CCGGCCTCTCTCTTAACCGCTACTTCTCGAGAAGTAGCGGTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010812
VALIDATED
FOXK1 MISSION shRNA shRNA Plasmid DNA
forkhead box K1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000085683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010812.1-1128s1c1
Sequence:CCGGCGTGGAACAAGCATTCCGAAACTCGAGTTTCGGAATGCTTGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010812.1-936s1c1
Sequence:CCGGGCTAACACTAAGTGGCATCTACTCGAGTAGATGCCACTTAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010812.1-555s1c1
Sequence:CCGGGATCCAGTTCACATCGCTATACTCGAGTATAGCGATGTGAACTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010812.1-1029s1c1
Sequence:CCGGCCTCTCTCTTAACCGCTACTTCTCGAGAAGTAGCGGTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010812
VALIDATED
FOXK1 MISSION shRNA Lentiviral Transduction Particles
forkhead box K1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000085683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010812.1-1128s1c1
Sequence:CCGGCGTGGAACAAGCATTCCGAAACTCGAGTTTCGGAATGCTTGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010812.1-936s1c1
Sequence:CCGGGCTAACACTAAGTGGCATCTACTCGAGTAGATGCCACTTAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010812.1-555s1c1
Sequence:CCGGGATCCAGTTCACATCGCTATACTCGAGTATAGCGATGTGAACTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010812.1-1029s1c1
Sequence:CCGGCCTCTCTCTTAACCGCTACTTCTCGAGAAGTAGCGGTTAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks