EMAIL THIS PAGE TO A FRIEND

FOXK2

forkhead box K2

130 Gene Product Result for
Synonyms: ILF ILF-1 ILF1
UniProtKB ID: Q01167, A6NEP5, Q13622, Q13623, Q13624
Gene ID:
Human(3607) Summary: The protein encoded by this gene contains a fork head DNA binding domain. This protein can bind to the purine-rich motifs of the HIV long terminal repeat (LTR), and to the similar purine-rich motif in the interleukin 2 (IL2) promoter. It may be involved in the regulation of viral and cellular promoter elements. [provided by RefSeq, Jul 2008]
Mouse(68837) forkhead box K2
Rat(303753) forkhead box K2
naked mole-rat(101698315) forkhead box K2
Domestic Rabbit(100345809) forkhead box K2
Zebrafish(324141) forkhead box K2
cow(532359) forkhead box K2
Horse(100056711) forkhead box K2
domestic cat(101083309) forkhead box K2
chicken(427798) forkhead box K2
dog(491681) forkhead box K2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004514 Rosetta Predictions human pricing
NM_181430 Rosetta Predictions human pricing
NM_181431 Rosetta Predictions human pricing
NM_001107075 Rosetta Predictions rat pricing
NM_001080932 Rosetta Predictions mouse pricing
XM_126489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337785 predicted 1087
2 SASI_Hs01_00190897 predicted 830
3 SASI_Hs02_00337786 predicted 974
4 SASI_Hs02_00337787 predicted 966
5 SASI_Hs02_00337788 predicted 1045
6 SASI_Hs02_00337789 predicted 875
7 SASI_Hs02_00337790 predicted 768
8 SASI_Hs02_00337791 predicted 1078
9 SASI_Hs02_00337792 predicted 1285
10 SASI_Hs02_00337793 predicted 1758
11 SASI_Hs01_00190896 predicted 2294
12 SASI_Hs01_00190898 predicted 2396
13 SASI_Hs01_00190899 predicted 2627
14 SASI_Hs01_00190900 predicted 2621
15 SASI_Hs01_00190901 predicted 2553
16 SASI_Hs01_00190902 predicted 771
17 SASI_Hs01_00190903 predicted 2397
18 SASI_Hs01_00190904 predicted 2309
19 SASI_Hs01_00190905 predicted 2257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036496 predicted 837
2 SASI_Hs01_00036497 predicted 774
3 SASI_Hs01_00036498 predicted 862
4 SASI_Hs01_00036499 predicted 1094
5 SASI_Hs01_00036500 predicted 982
6 SASI_Hs01_00036501 predicted 965
7 SASI_Hs01_00036502 predicted 1106
8 SASI_Hs01_00036503 predicted 1046
9 SASI_Hs01_00036504 predicted 876
10 SASI_Hs01_00036505 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104688 predicted 1416
2 SASI_Hs01_00104689 predicted 831
3 SASI_Hs01_00104690 predicted 1512
4 SASI_Hs01_00104691 predicted 777
5 SASI_Hs01_00104692 predicted 1519
6 SASI_Hs01_00104693 predicted 1430
7 SASI_Hs01_00104694 predicted 1372
8 SASI_Hs01_00104695 predicted 860
9 SASI_Hs01_00104696 predicted 977
10 SASI_Hs01_00104697 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225246 predicted 373
2 SASI_Rn02_00225247 predicted 295
3 SASI_Rn02_00225248 predicted 619
4 SASI_Rn02_00225249 predicted 989
5 SASI_Rn02_00225250 predicted 1172
6 SASI_Rn02_00225251 predicted 1220
7 SASI_Rn02_00225252 predicted 1456
8 SASI_Rn02_00225253 predicted 397
9 SASI_Rn02_00225254 predicted 514
10 SASI_Rn02_00225255 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294023 predicted 1734
2 SASI_Mm02_00294024 predicted 1369
3 SASI_Mm02_00294025 predicted 1106
4 SASI_Mm02_00294026 predicted 1264
5 SASI_Mm02_00294027 predicted 1972
6 SASI_Mm02_00294028 predicted 2020
7 SASI_Mm02_00294029 predicted 1215
8 SASI_Mm02_00294030 predicted 2340
9 SASI_Mm02_00294031 predicted 1269
10 SASI_Mm02_00294032 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229541 predicted 1735
2 SASI_Mm01_00229542 predicted 1375
3 SASI_Mm01_00229543 predicted 1112
4 SASI_Mm01_00229544 predicted 1269
5 SASI_Mm01_00229545 predicted 1977
6 SASI_Mm01_00229546 predicted 2016
7 SASI_Mm01_00229547 predicted 1222
8 SASI_Mm01_00229548 predicted 1277
9 SASI_Mm01_00229549 predicted 2148
10 SASI_Mm01_00229550 predicted 1778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004514
VALIDATED
FOXK2 MISSION shRNA Bacterial Glycerol Stock
forkhead box K2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004514.2-2287s1c1
Sequence:CCGGGCTGGCCTTAACACTCCTTAACTCGAGTTAAGGAGTGTTAAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-864s1c1
Sequence:CCGGCCTCAATTTAATGGCTGACAACTCGAGTTGTCAGCCATTAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-1177s1c1
Sequence:CCGGCCAGCCTCTGAAAGCAAATTACTCGAGTAATTTGCTTTCAGAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-300s1c1
Sequence:CCGGCGAGTTCGAGTATCTGATGAACTCGAGTTCATCAGATACTCGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-606s1c1
Sequence:CCGGCCCGAGCACAAACATCAAGATCTCGAGATCTTGATGTTTGTGCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-983s21c1
Sequence:CCGGTTACGATGGCTCCCGACAAACCTCGAGGTTTGTCGGGAGCCATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-2550s21c1
Sequence:CCGGAGCGGAGACATGTGGAATTAGCTCGAGCTAATTCCACATGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-606s21c1
Sequence:CCGGCCCGAGCACAAACATCAAGATCTCGAGATCTTGATGTTTGTGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004514.3-1177s21c1
Sequence:CCGGCCAGCCTCTGAAAGCAAATTACTCGAGTAATTTGCTTTCAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-1006s21c1
Sequence:CCGGCTCACCCTGAACGGGATTTATCTCGAGATAAATCCCGTTCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004514
VALIDATED
FOXK2 MISSION shRNA shRNA Plasmid DNA
forkhead box K2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004514.2-2287s1c1
Sequence:CCGGGCTGGCCTTAACACTCCTTAACTCGAGTTAAGGAGTGTTAAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-864s1c1
Sequence:CCGGCCTCAATTTAATGGCTGACAACTCGAGTTGTCAGCCATTAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-1177s1c1
Sequence:CCGGCCAGCCTCTGAAAGCAAATTACTCGAGTAATTTGCTTTCAGAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-300s1c1
Sequence:CCGGCGAGTTCGAGTATCTGATGAACTCGAGTTCATCAGATACTCGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-606s1c1
Sequence:CCGGCCCGAGCACAAACATCAAGATCTCGAGATCTTGATGTTTGTGCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-983s21c1
Sequence:CCGGTTACGATGGCTCCCGACAAACCTCGAGGTTTGTCGGGAGCCATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-2550s21c1
Sequence:CCGGAGCGGAGACATGTGGAATTAGCTCGAGCTAATTCCACATGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-606s21c1
Sequence:CCGGCCCGAGCACAAACATCAAGATCTCGAGATCTTGATGTTTGTGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004514.3-1177s21c1
Sequence:CCGGCCAGCCTCTGAAAGCAAATTACTCGAGTAATTTGCTTTCAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-1006s21c1
Sequence:CCGGCTCACCCTGAACGGGATTTATCTCGAGATAAATCCCGTTCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004514
VALIDATED
FOXK2 MISSION shRNA Lentiviral Transduction Particles
forkhead box K2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004514.2-2287s1c1
Sequence:CCGGGCTGGCCTTAACACTCCTTAACTCGAGTTAAGGAGTGTTAAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-864s1c1
Sequence:CCGGCCTCAATTTAATGGCTGACAACTCGAGTTGTCAGCCATTAAATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-1177s1c1
Sequence:CCGGCCAGCCTCTGAAAGCAAATTACTCGAGTAATTTGCTTTCAGAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-300s1c1
Sequence:CCGGCGAGTTCGAGTATCTGATGAACTCGAGTTCATCAGATACTCGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004514.2-606s1c1
Sequence:CCGGCCCGAGCACAAACATCAAGATCTCGAGATCTTGATGTTTGTGCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-983s21c1
Sequence:CCGGTTACGATGGCTCCCGACAAACCTCGAGGTTTGTCGGGAGCCATCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-2550s21c1
Sequence:CCGGAGCGGAGACATGTGGAATTAGCTCGAGCTAATTCCACATGTCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-606s21c1
Sequence:CCGGCCCGAGCACAAACATCAAGATCTCGAGATCTTGATGTTTGTGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004514.3-1177s21c1
Sequence:CCGGCCAGCCTCTGAAAGCAAATTACTCGAGTAATTTGCTTTCAGAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004514.3-1006s21c1
Sequence:CCGGCTCACCCTGAACGGGATTTATCTCGAGATAAATCCCGTTCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080932
VALIDATED
FOXK2 MISSION shRNA Bacterial Glycerol Stock
forkhead box K2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-1097s21c1
Sequence:CCGGCAGGGTCTTCAGGGTACAAAGCTCGAGCTTTGTACCCTGAAGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-876s21c1
Sequence:CCGGCAGGTTTCCGAGCACAAATATCTCGAGATATTTGTGCTCGGAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-3316s21c1
Sequence:CCGGACTTTGTCCTTGGCGTAATTTCTCGAGAAATTACGCCAAGGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-1374s21c1
Sequence:CCGGTCTCTCTCTGAACCGTTATTTCTCGAGAAATAACGGTTCAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-2326s21c1
Sequence:CCGGCCAGAGCTCAAGCGAGTTAAACTCGAGTTTAACTCGCTTGAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080932
VALIDATED
FOXK2 MISSION shRNA shRNA Plasmid DNA
forkhead box K2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-1097s21c1
Sequence:CCGGCAGGGTCTTCAGGGTACAAAGCTCGAGCTTTGTACCCTGAAGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-876s21c1
Sequence:CCGGCAGGTTTCCGAGCACAAATATCTCGAGATATTTGTGCTCGGAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-3316s21c1
Sequence:CCGGACTTTGTCCTTGGCGTAATTTCTCGAGAAATTACGCCAAGGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-1374s21c1
Sequence:CCGGTCTCTCTCTGAACCGTTATTTCTCGAGAAATAACGGTTCAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-2326s21c1
Sequence:CCGGCCAGAGCTCAAGCGAGTTAAACTCGAGTTTAACTCGCTTGAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080932
VALIDATED
FOXK2 MISSION shRNA Lentiviral Transduction Particles
forkhead box K2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-1097s21c1
Sequence:CCGGCAGGGTCTTCAGGGTACAAAGCTCGAGCTTTGTACCCTGAAGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-876s21c1
Sequence:CCGGCAGGTTTCCGAGCACAAATATCTCGAGATATTTGTGCTCGGAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238927    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-3316s21c1
Sequence:CCGGACTTTGTCCTTGGCGTAATTTCTCGAGAAATTACGCCAAGGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-1374s21c1
Sequence:CCGGTCTCTCTCTGAACCGTTATTTCTCGAGAAATAACGGTTCAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001080932.1-2326s21c1
Sequence:CCGGCCAGAGCTCAAGCGAGTTAAACTCGAGTTTAACTCGCTTGAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks