EMAIL THIS PAGE TO A FRIEND

FOXL1

forkhead box L1

59 Gene Product Result for
Synonyms: FKH6 FKHL11 FREAC7
UniProtKB ID: Q12952, Q17RR1, Q9H242
Gene ID:
Human(2300) Summary: This gene encodes a member of the forkhead/winged helix-box (FOX) family of transcription factors. FOX transcription factors are characterized by a distinct DNA-binding forkhead domain and play critical roles in the regulation of multiple processes including metabolism, cell proliferation and gene expression during ontogenesis. [provided by RefSeq, Nov 2012]
Mouse(14241) forkhead box L1
Zebrafish(393959) forkhead box L1
dog(609291) forkhead box L1
cow(538955) forkhead box L1
chicken(768576) forkhead box L1
sheep(101103750) forkhead box L1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100848 Anti-FOXL1 (ab1) antibody produced in rabbit affinity isolated antibody canine, human
western blot pricing
SAB2100849 Anti-FOXL1 (ab2) antibody produced in rabbit affinity isolated antibody canine, rabbit, human, horse
western blot pricing
SAB1411949 ANTI-FOXL1 antibody produced in mouse clone 2A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412304 ANTI-FOXL1 antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412305 ANTI-FOXL1 antibody produced in mouse clone 3C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412306 ANTI-FOXL1 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412307 ANTI-FOXL1 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412308 ANTI-FOXL1 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412309 ANTI-FOXL1 antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412310 ANTI-FOXL1 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV32303 Anti-FOXL1 antibody produced in rabbit IgG fraction of antiserum canine, horse, human, rabbit, mouse
immunohistochemistry, western blot pricing
SAB4500926 Anti-FOXL1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0002300M3 Monoclonal Anti-FOXL1 antibody produced in mouse clone 1A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403825 Monoclonal Anti-FOXL1 antibody produced in mouse clone 1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005250 Rosetta Predictions human pricing
NM_008024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339271 predicted 1520
2 SASI_Hs02_00339272 predicted 1226
3 SASI_Hs01_00151125 predicted 969
4 SASI_Hs02_00339273 predicted 1525
5 SASI_Hs01_00151126 predicted 616
6 SASI_Hs02_00339274 predicted 1596
7 SASI_Hs02_00339275 predicted 1549
8 SASI_Hs02_00339276 predicted 1634
9 SASI_Hs01_00151131 predicted 1156
10 SASI_Hs02_00339277 predicted 1541
11 SASI_Hs01_00151127 predicted 776
12 SASI_Hs01_00151128 predicted 750
13 SASI_Hs01_00151129 predicted 750
14 SASI_Hs01_00151130 predicted 138
15 SASI_Hs01_00151132 predicted 927
16 SASI_Hs01_00151133 predicted 141
17 SASI_Hs01_00151134 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058268 predicted 651
2 SASI_Mm01_00058269 predicted 1012
3 SASI_Mm02_00312967 predicted 1480
4 SASI_Mm02_00312968 predicted 1670
5 SASI_Mm02_00312969 predicted 1298
6 SASI_Mm02_00312970 predicted 1578
7 SASI_Mm01_00058277 predicted 435
8 SASI_Mm02_00312971 predicted 1036
9 SASI_Mm02_00312972 predicted 1331
10 SASI_Mm02_00312973 predicted 1445
11 SASI_Mm01_00058270 predicted 408
12 SASI_Mm01_00058271 predicted 752
13 SASI_Mm01_00058272 predicted 407
14 SASI_Mm01_00058273 predicted 758
15 SASI_Mm01_00058274 predicted 318
16 SASI_Mm01_00058275 predicted 953
17 SASI_Mm01_00058276 predicted 144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005250
FOXL1 MISSION shRNA Bacterial Glycerol Stock
forkhead box L1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005250.2-1452s21c1
Sequence:CCGGGAGCAGCTACGGAGACTTAAACTCGAGTTTAAGTCTCCGTAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005250.2-1365s21c1
Sequence:CCGGGTGGGTTCAGGGAAGTGTTACCTCGAGGTAACACTTCCCTGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005250.2-1134s21c1
Sequence:CCGGCCTTTCAACGCTTCCCTGATGCTCGAGCATCAGGGAAGCGTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-384s1c1
Sequence:CCGGCTGCCTGGACATGTTTGAGAACTCGAGTTCTCAAACATGTCCAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-46s1c1
Sequence:CCGGCCCATGCTGTATCTGTACGGTCTCGAGACCGTACAGATACAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-750s1c1
Sequence:CCGGCTCTCCGAAGAGCTCCGACAACTCGAGTTGTCGGAGCTCTTCGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-773s1c1
Sequence:CCGGCCAAGAGCTTCAGCATAGACACTCGAGTGTCTATGCTGAAGCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-219s1c1
Sequence:CCGGCGGCATCTACCAGTTCATCATCTCGAGATGATGAACTGGTAGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005250
FOXL1 MISSION shRNA shRNA Plasmid DNA
forkhead box L1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005250.2-1452s21c1
Sequence:CCGGGAGCAGCTACGGAGACTTAAACTCGAGTTTAAGTCTCCGTAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005250.2-1365s21c1
Sequence:CCGGGTGGGTTCAGGGAAGTGTTACCTCGAGGTAACACTTCCCTGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005250.2-1134s21c1
Sequence:CCGGCCTTTCAACGCTTCCCTGATGCTCGAGCATCAGGGAAGCGTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-384s1c1
Sequence:CCGGCTGCCTGGACATGTTTGAGAACTCGAGTTCTCAAACATGTCCAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-46s1c1
Sequence:CCGGCCCATGCTGTATCTGTACGGTCTCGAGACCGTACAGATACAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-750s1c1
Sequence:CCGGCTCTCCGAAGAGCTCCGACAACTCGAGTTGTCGGAGCTCTTCGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-773s1c1
Sequence:CCGGCCAAGAGCTTCAGCATAGACACTCGAGTGTCTATGCTGAAGCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-219s1c1
Sequence:CCGGCGGCATCTACCAGTTCATCATCTCGAGATGATGAACTGGTAGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005250
FOXL1 MISSION shRNA Lentiviral Transduction Particles
forkhead box L1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005250.2-1452s21c1
Sequence:CCGGGAGCAGCTACGGAGACTTAAACTCGAGTTTAAGTCTCCGTAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005250.2-1365s21c1
Sequence:CCGGGTGGGTTCAGGGAAGTGTTACCTCGAGGTAACACTTCCCTGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005250.2-1134s21c1
Sequence:CCGGCCTTTCAACGCTTCCCTGATGCTCGAGCATCAGGGAAGCGTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-384s1c1
Sequence:CCGGCTGCCTGGACATGTTTGAGAACTCGAGTTCTCAAACATGTCCAGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-46s1c1
Sequence:CCGGCCCATGCTGTATCTGTACGGTCTCGAGACCGTACAGATACAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-750s1c1
Sequence:CCGGCTCTCCGAAGAGCTCCGACAACTCGAGTTGTCGGAGCTCTTCGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-773s1c1
Sequence:CCGGCCAAGAGCTTCAGCATAGACACTCGAGTGTCTATGCTGAAGCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005250.1-219s1c1
Sequence:CCGGCGGCATCTACCAGTTCATCATCTCGAGATGATGAACTGGTAGATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008024
FOXL1 MISSION shRNA Bacterial Glycerol Stock
forkhead box L1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-745s1c1
Sequence:CCGGAGGTTCCAAGTCAAAGAGTTTCTCGAGAAACTCTTTGACTTGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-405s1c1
Sequence:CCGGCGGCAATTATCGGCGCAGGAACTCGAGTTCCTGCGCCGATAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-165s1c1
Sequence:CCGGCGCTCTTATAGCCATGGCGATCTCGAGATCGCCATGGCTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-42s1c1
Sequence:CCGGCTCGCCGCTGTTGTACGTGTACTCGAGTACACGTACAACAGCGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-393s1c1
Sequence:CCGGCATGTTTGAGAACGGCAATTACTCGAGTAATTGCCGTTCTCAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008024
FOXL1 MISSION shRNA shRNA Plasmid DNA
forkhead box L1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-745s1c1
Sequence:CCGGAGGTTCCAAGTCAAAGAGTTTCTCGAGAAACTCTTTGACTTGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-405s1c1
Sequence:CCGGCGGCAATTATCGGCGCAGGAACTCGAGTTCCTGCGCCGATAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-165s1c1
Sequence:CCGGCGCTCTTATAGCCATGGCGATCTCGAGATCGCCATGGCTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-42s1c1
Sequence:CCGGCTCGCCGCTGTTGTACGTGTACTCGAGTACACGTACAACAGCGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-393s1c1
Sequence:CCGGCATGTTTGAGAACGGCAATTACTCGAGTAATTGCCGTTCTCAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008024
FOXL1 MISSION shRNA Lentiviral Transduction Particles
forkhead box L1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-745s1c1
Sequence:CCGGAGGTTCCAAGTCAAAGAGTTTCTCGAGAAACTCTTTGACTTGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-405s1c1
Sequence:CCGGCGGCAATTATCGGCGCAGGAACTCGAGTTCCTGCGCCGATAATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-165s1c1
Sequence:CCGGCGCTCTTATAGCCATGGCGATCTCGAGATCGCCATGGCTATAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-42s1c1
Sequence:CCGGCTCGCCGCTGTTGTACGTGTACTCGAGTACACGTACAACAGCGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008024.1-393s1c1
Sequence:CCGGCATGTTTGAGAACGGCAATTACTCGAGTAATTGCCGTTCTCAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks