EMAIL THIS PAGE TO A FRIEND

FOXL2

forkhead box L2

102 Gene Product Result for
Synonyms: BPES BPES1 PFRK PINTO POF3
UniProtKB ID: P58012, Q4ZGJ3
Gene ID:
Human(668) Summary: This gene encodes a forkhead transcription factor. The protein contains a fork-head DNA-binding domain and may play a role in ovarian development and function. Mutations in this gene are a cause of blepharophimosis syndrome and premature ovarian failure 3. [provided by RefSeq, Jun 2009]
Mouse(26927) forkhead box L2
Rat(367152) forkhead box L2
Goat(100750236) forkhead box L2
Domestic Rabbit(100328926) forkhead box L2
naked mole-rat(101716168) forkhead box L2
Zebrafish(692279) forkhead box L2
cow(281770) forkhead box L2
dog(100687445) forkhead box L2
chicken(503512) forkhead box L2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023067 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023067 Rosetta Predictions human pricing
XM_001070279 Rosetta Predictions rat pricing
XM_345975 Rosetta Predictions rat pricing
NM_012020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059944 predicted 1549
2 SASI_Hs01_00059945 predicted 1849
3 SASI_Hs01_00059951 predicted 1857
4 SASI_Hs01_00059946 predicted 1614
5 SASI_Hs01_00059948 predicted 488
6 SASI_Hs01_00059949 predicted 1632
7 SASI_Hs01_00059950 predicted 486
8 SASI_Hs02_00356306 predicted 1618
9 SASI_Hs01_00059952 predicted 506
10 SASI_Hs01_00059953 predicted 1292
11 SASI_Hs01_00059947 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331094 predicted 623
2 SASI_Rn02_00331095 predicted 582
3 SASI_Rn02_00331096 predicted 568
4 SASI_Rn02_00331097 predicted 577
5 SASI_Rn02_00331098 predicted 625
6 SASI_Rn02_00331099 predicted 580
7 SASI_Rn02_00331100 predicted 921
8 SASI_Rn02_00331101 predicted 619
9 SASI_Rn02_00331102 predicted 530
10 SASI_Rn02_00331103 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398942 predicted 620
2 SASI_Rn02_00398943 predicted 583
3 SASI_Rn02_00398944 predicted 566
4 SASI_Rn02_00398945 predicted 576
5 SASI_Rn02_00398946 predicted 622
6 SASI_Rn02_00398947 predicted 586
7 SASI_Rn02_00398948 predicted 916
8 SASI_Rn02_00398949 predicted 614
9 SASI_Rn02_00398950 predicted 524
10 SASI_Rn02_00398951 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163435 predicted 203
2 SASI_Mm01_00163437 predicted 207
3 SASI_Mm01_00163438 predicted 552
4 SASI_Mm01_00163439 predicted 241
5 SASI_Mm01_00163440 predicted 380
6 SASI_Mm02_00321973 predicted 240
7 SASI_Mm01_00163441 predicted 342
8 SASI_Mm01_00163442 predicted 238
9 SASI_Mm01_00163443 predicted 214
10 SASI_Mm01_00163444 predicted 415
11 SASI_Mm01_00163436 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012020
FOXL2 MISSION shRNA Bacterial Glycerol Stock
forkhead box L2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-210s1c1
Sequence:CCGGGCTCACTCTGTCCGGCATCTACTCGAGTAGATGCCGGACAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-231s1c1
Sequence:CCGGCCAGTACATCATAGCCAAGTTCTCGAGAACTTGGCTATGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-252s1c1
Sequence:CCGGCCCGTTCTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-222s1c1
Sequence:CCGGCGGCATCTACCAGTACATCATCTCGAGATGATGTACTGGTAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-396s1c1
Sequence:CCGGCATGTTCGAGAAGGGCAACTACTCGAGTAGTTGCCCTTCTCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1518s21c1
Sequence:CCGGCTTACCTCTTGGCCCTCTCTTCTCGAGAAGAGAGGGCCAAGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1677s21c1
Sequence:CCGGCCCTCCTGGAACTGATCAGAACTCGAGTTCTGATCAGTTCCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1643s21c1
Sequence:CCGGAGAATGGAAAGAACGTGTCTGCTCGAGCAGACACGTTCTTTCCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012020
FOXL2 MISSION shRNA shRNA Plasmid DNA
forkhead box L2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-210s1c1
Sequence:CCGGGCTCACTCTGTCCGGCATCTACTCGAGTAGATGCCGGACAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-231s1c1
Sequence:CCGGCCAGTACATCATAGCCAAGTTCTCGAGAACTTGGCTATGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-252s1c1
Sequence:CCGGCCCGTTCTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-222s1c1
Sequence:CCGGCGGCATCTACCAGTACATCATCTCGAGATGATGTACTGGTAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-396s1c1
Sequence:CCGGCATGTTCGAGAAGGGCAACTACTCGAGTAGTTGCCCTTCTCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1518s21c1
Sequence:CCGGCTTACCTCTTGGCCCTCTCTTCTCGAGAAGAGAGGGCCAAGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1677s21c1
Sequence:CCGGCCCTCCTGGAACTGATCAGAACTCGAGTTCTGATCAGTTCCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1643s21c1
Sequence:CCGGAGAATGGAAAGAACGTGTCTGCTCGAGCAGACACGTTCTTTCCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012020
FOXL2 MISSION shRNA Lentiviral Transduction Particles
forkhead box L2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-210s1c1
Sequence:CCGGGCTCACTCTGTCCGGCATCTACTCGAGTAGATGCCGGACAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-231s1c1
Sequence:CCGGCCAGTACATCATAGCCAAGTTCTCGAGAACTTGGCTATGATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-252s1c1
Sequence:CCGGCCCGTTCTACGAGAAGAACAACTCGAGTTGTTCTTCTCGTAGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-222s1c1
Sequence:CCGGCGGCATCTACCAGTACATCATCTCGAGATGATGTACTGGTAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012020.1-396s1c1
Sequence:CCGGCATGTTCGAGAAGGGCAACTACTCGAGTAGTTGCCCTTCTCGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1518s21c1
Sequence:CCGGCTTACCTCTTGGCCCTCTCTTCTCGAGAAGAGAGGGCCAAGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1677s21c1
Sequence:CCGGCCCTCCTGGAACTGATCAGAACTCGAGTTCTGATCAGTTCCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012020.2-1643s21c1
Sequence:CCGGAGAATGGAAAGAACGTGTCTGCTCGAGCAGACACGTTCTTTCCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023067
FOXL2 MISSION shRNA Bacterial Glycerol Stock
forkhead box L2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023067.2-2359s1c1
Sequence:CCGGCCCTCTCCCTATCTGAAGAAACTCGAGTTTCTTCAGATAGGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-480s1c1
Sequence:CCGGCCAGTACATCATCGCGAAGTTCTCGAGAACTTCGCGATGATGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-498s1c1
Sequence:CCGGGTTCCCGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACGGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-1041s1c1
Sequence:CCGGCGGCGTAGTGAACTCGTACAACTCGAGTTGTACGAGTTCACTACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-1296s1c1
Sequence:CCGGCGCCATGATGCATTGCTCTTACTCGAGTAAGAGCAATGCATCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023067.3-1850s21c1
Sequence:CCGGAGCGTCTCCTGCCCAAATTCACTCGAGTGAATTTGGGCAGGAGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023067.3-1005s21c1
Sequence:CCGGAGTCTGGCTTCCTCAACAACTCTCGAGAGTTGTTGAGGAAGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023067
FOXL2 MISSION shRNA shRNA Plasmid DNA
forkhead box L2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023067.2-2359s1c1
Sequence:CCGGCCCTCTCCCTATCTGAAGAAACTCGAGTTTCTTCAGATAGGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-480s1c1
Sequence:CCGGCCAGTACATCATCGCGAAGTTCTCGAGAACTTCGCGATGATGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-498s1c1
Sequence:CCGGGTTCCCGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACGGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-1041s1c1
Sequence:CCGGCGGCGTAGTGAACTCGTACAACTCGAGTTGTACGAGTTCACTACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-1296s1c1
Sequence:CCGGCGCCATGATGCATTGCTCTTACTCGAGTAAGAGCAATGCATCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023067.3-1850s21c1
Sequence:CCGGAGCGTCTCCTGCCCAAATTCACTCGAGTGAATTTGGGCAGGAGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023067.3-1005s21c1
Sequence:CCGGAGTCTGGCTTCCTCAACAACTCTCGAGAGTTGTTGAGGAAGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023067
FOXL2 MISSION shRNA Lentiviral Transduction Particles
forkhead box L2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023067.2-2359s1c1
Sequence:CCGGCCCTCTCCCTATCTGAAGAAACTCGAGTTTCTTCAGATAGGGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-480s1c1
Sequence:CCGGCCAGTACATCATCGCGAAGTTCTCGAGAACTTCGCGATGATGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-498s1c1
Sequence:CCGGGTTCCCGTTCTACGAGAAGAACTCGAGTTCTTCTCGTAGAACGGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-1041s1c1
Sequence:CCGGCGGCGTAGTGAACTCGTACAACTCGAGTTGTACGAGTTCACTACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023067.2-1296s1c1
Sequence:CCGGCGCCATGATGCATTGCTCTTACTCGAGTAAGAGCAATGCATCATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023067.3-1850s21c1
Sequence:CCGGAGCGTCTCCTGCCCAAATTCACTCGAGTGAATTTGGGCAGGAGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023067.3-1005s21c1
Sequence:CCGGAGTCTGGCTTCCTCAACAACTCTCGAGAGTTGTTGAGGAAGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks