EMAIL THIS PAGE TO A FRIEND

FOXM1

forkhead box M1

136 Gene Product Result for
Synonyms: FKHL16 FOXM1B HFH-11 HFH11 HNF-3 INS-1 MPHOSPH2 MPP-2 MPP2 PIG29 TGT3 TRIDENT
UniProtKB ID: Q08050, O43258, O43259, O43260, Q4ZGG7, Q9BRL2
Gene ID:
Human(2305) Summary: The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(14235) forkhead box M1
Rat(58921) forkhead box M1
sheep(101113491) forkhead box M1
naked mole-rat(101712494) forkhead box M1
Zebrafish(394072) forkhead box M1
cow(513643) forkhead box M1
Horse(100050775) forkhead box M1
domestic cat(101089113) forkhead box M1
chicken(430534) forkhead box M1
dog(486743) forkhead box M1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100850 Anti-FOXM1 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, rat, canine, mouse, guinea pig, human
western blot pricing
SAB2100851 Anti-FOXM1 (ab2) antibody produced in rabbit affinity isolated antibody human, rabbit, rat, mouse, guinea pig, canine
western blot pricing
SAB1412254 ANTI-FOXM1 antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412255 ANTI-FOXM1 antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412256 ANTI-FOXM1 antibody produced in mouse clone 3E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412277 ANTI-FOXM1 antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107970 Anti-FOXM1 antibody produced in rabbit affinity isolated antibody rat, pig, human, canine, horse, rabbit, mouse
western blot pricing
AV39518 Anti-FOXM1 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, canine, mouse
western blot pricing
HPA029974 Anti-FOXM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA029975 Anti-FOXM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
HPA029976 Anti-FOXM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1403827 Monoclonal Anti-FOXM1, (C-terminal) antibody produced in mouse clone 3A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0355 AQUA Peptide DPLPD[P]LLDK human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021953 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021953 Rosetta Predictions human pricing
NM_202002 Rosetta Predictions human pricing
NM_202003 Rosetta Predictions human pricing
NM_031633 Rosetta Predictions rat pricing
NM_008021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243977 predicted 2330
2 SASI_Hs01_00243978 predicted 341
3 SASI_Hs01_00243979 predicted 2652
4 SASI_Hs01_00243980 predicted 567
5 SASI_Hs01_00243981 predicted 2164
6 SASI_Hs01_00243982 predicted 2514
7 SASI_Hs01_00243983 predicted 975
8 SASI_Hs01_00243984 predicted 785
9 SASI_Hs01_00243985 predicted 553
10 SASI_Hs01_00243986 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052108 predicted 2447
2 SASI_Hs01_00052109 predicted 335
3 SASI_Hs01_00052110 predicted 2759
4 SASI_Hs01_00052111 predicted 563
5 SASI_Hs01_00052112 predicted 2277
6 SASI_Hs01_00052113 predicted 2632
7 SASI_Hs01_00052114 predicted 975
8 SASI_Hs01_00052115 predicted 785
9 SASI_Hs01_00052116 predicted 554
10 SASI_Hs01_00052117 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193782 predicted 2280
2 SASI_Hs01_00193783 predicted 344
3 SASI_Hs01_00193784 predicted 2607
4 SASI_Hs01_00193785 predicted 566
5 SASI_Hs01_00193786 predicted 2122
6 SASI_Hs01_00193787 predicted 2474
7 SASI_Hs01_00193788 predicted 979
8 SASI_Hs01_00193789 predicted 781
9 SASI_Hs01_00193790 predicted 552
10 SASI_Hs01_00193791 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112221 predicted 1279
2 SASI_Rn01_00112222 predicted 716
3 SASI_Rn01_00112223 predicted 2421
4 SASI_Rn02_00264939 predicted 260
5 SASI_Rn01_00112224 predicted 1151
6 SASI_Rn01_00112225 predicted 802
7 SASI_Rn01_00112226 predicted 1064
8 SASI_Rn01_00112227 predicted 1059
9 SASI_Rn01_00112228 predicted 1697
10 SASI_Rn01_00112229 predicted 791
11 SASI_Rn01_00112220 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100165 predicted 759
2 SASI_Mm01_00100166 predicted 794
3 SASI_Mm01_00100167 predicted 1208
4 SASI_Mm01_00100168 predicted 876
5 SASI_Mm01_00100169 predicted 2472
6 SASI_Mm01_00100170 predicted 917
7 SASI_Mm01_00100171 predicted 1429
8 SASI_Mm01_00100172 predicted 1116
9 SASI_Mm01_00100173 predicted 351
10 SASI_Mm02_00312965 predicted 1103
11 SASI_Mm01_00100164 predicted 1031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008021
VALIDATED
FOXM1 MISSION shRNA Bacterial Glycerol Stock
forkhead box M1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1111s21c1
Sequence:CCGGCGCTACTTGACATTGGACCAACTCGAGTTGGTCCAATGTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1527s21c1
Sequence:CCGGACTTCCTATTCAGTCCATTAACTCGAGTTAATGGACTGAATAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1583s21c1
Sequence:CCGGACTTAGAGAGGCCTATCAAAGCTCGAGCTTTGATAGGCCTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-881s21c1
Sequence:CCGGACTCTTATATGGCCATGATACCTCGAGGTATCATGGCCATATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-2793s21c1
Sequence:CCGGGCGTATTTCCTTAGCTCATTACTCGAGTAATGAGCTAAGGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008021.2-1150s1c1
Sequence:CCGGGCTCCATAGAAATGTGACCATCTCGAGATGGTCACATTTCTATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008021.2-1584s1c1
Sequence:CCGGCATCGCTCAAAGAGGAGCTATCTCGAGATAGCTCCTCTTTGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008021.2-1052s1c1
Sequence:CCGGCGCTACTTGACATTGGACCAACTCGAGTTGGTCCAATGTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008021.2-634s1c1
Sequence:CCGGGCTGGACAACAGCTTAACCAACTCGAGTTGGTTAAGCTGTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008021
VALIDATED
FOXM1 MISSION shRNA shRNA Plasmid DNA
forkhead box M1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1111s21c1
Sequence:CCGGCGCTACTTGACATTGGACCAACTCGAGTTGGTCCAATGTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1527s21c1
Sequence:CCGGACTTCCTATTCAGTCCATTAACTCGAGTTAATGGACTGAATAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1583s21c1
Sequence:CCGGACTTAGAGAGGCCTATCAAAGCTCGAGCTTTGATAGGCCTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-881s21c1
Sequence:CCGGACTCTTATATGGCCATGATACCTCGAGGTATCATGGCCATATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-2793s21c1
Sequence:CCGGGCGTATTTCCTTAGCTCATTACTCGAGTAATGAGCTAAGGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008021.2-1150s1c1
Sequence:CCGGGCTCCATAGAAATGTGACCATCTCGAGATGGTCACATTTCTATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008021.2-1584s1c1
Sequence:CCGGCATCGCTCAAAGAGGAGCTATCTCGAGATAGCTCCTCTTTGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008021.2-1052s1c1
Sequence:CCGGCGCTACTTGACATTGGACCAACTCGAGTTGGTCCAATGTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008021.2-634s1c1
Sequence:CCGGGCTGGACAACAGCTTAACCAACTCGAGTTGGTTAAGCTGTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008021
VALIDATED
FOXM1 MISSION shRNA Lentiviral Transduction Particles
forkhead box M1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1111s21c1
Sequence:CCGGCGCTACTTGACATTGGACCAACTCGAGTTGGTCCAATGTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1527s21c1
Sequence:CCGGACTTCCTATTCAGTCCATTAACTCGAGTTAATGGACTGAATAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-1583s21c1
Sequence:CCGGACTTAGAGAGGCCTATCAAAGCTCGAGCTTTGATAGGCCTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-881s21c1
Sequence:CCGGACTCTTATATGGCCATGATACCTCGAGGTATCATGGCCATATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008021.4-2793s21c1
Sequence:CCGGGCGTATTTCCTTAGCTCATTACTCGAGTAATGAGCTAAGGAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008021.2-1150s1c1
Sequence:CCGGGCTCCATAGAAATGTGACCATCTCGAGATGGTCACATTTCTATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008021.2-1584s1c1
Sequence:CCGGCATCGCTCAAAGAGGAGCTATCTCGAGATAGCTCCTCTTTGAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008021.2-1052s1c1
Sequence:CCGGCGCTACTTGACATTGGACCAACTCGAGTTGGTCCAATGTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008021.2-634s1c1
Sequence:CCGGGCTGGACAACAGCTTAACCAACTCGAGTTGGTTAAGCTGTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021953
VALIDATED
FOXM1 MISSION shRNA Bacterial Glycerol Stock
forkhead box M1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-374s21c1
Sequence:CCGGGCCCAACAGGAGTCTAATCAACTCGAGTTGATTAGACTCCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021953.2-2876s21c1
Sequence:CCGGTTGCAGGGTGGTCCGTGTAAACTCGAGTTTACACGGACCACCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-1313s21c1
Sequence:CCGGCGCCGGAACATGACCATCAAACTCGAGTTTGATGGTCATGTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-2405s21c1
Sequence:CCGGGCCAATCGTTCTCTGACAGAACTCGAGTTCTGTCAGAGAACGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-1065s21c1
Sequence:CCGGAGGACCACTTTCCCTACTTTACTCGAGTAAAGTAGGGAAAGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021953.2-3186s1c1
Sequence:CCGGGCAAGAAGAAATCCTGGTTAACTCGAGTTAACCAGGATTTCTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-1313s1c1
Sequence:CCGGCGCCGGAACATGACCATCAAACTCGAGTTTGATGGTCATGTTCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-2405s1c1
Sequence:CCGGGCCAATCGTTCTCTGACAGAACTCGAGTTCTGTCAGAGAACGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-374s1c1
Sequence:CCGGGCCCAACAGGAGTCTAATCAACTCGAGTTGATTAGACTCCTGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-789s1c1
Sequence:CCGGGCACTATCAACAATAGCCTATCTCGAGATAGGCTATTGTTGATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021953
VALIDATED
FOXM1 MISSION shRNA shRNA Plasmid DNA
forkhead box M1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-374s21c1
Sequence:CCGGGCCCAACAGGAGTCTAATCAACTCGAGTTGATTAGACTCCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021953.2-2876s21c1
Sequence:CCGGTTGCAGGGTGGTCCGTGTAAACTCGAGTTTACACGGACCACCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-1313s21c1
Sequence:CCGGCGCCGGAACATGACCATCAAACTCGAGTTTGATGGTCATGTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-2405s21c1
Sequence:CCGGGCCAATCGTTCTCTGACAGAACTCGAGTTCTGTCAGAGAACGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-1065s21c1
Sequence:CCGGAGGACCACTTTCCCTACTTTACTCGAGTAAAGTAGGGAAAGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021953.2-3186s1c1
Sequence:CCGGGCAAGAAGAAATCCTGGTTAACTCGAGTTAACCAGGATTTCTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-1313s1c1
Sequence:CCGGCGCCGGAACATGACCATCAAACTCGAGTTTGATGGTCATGTTCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-2405s1c1
Sequence:CCGGGCCAATCGTTCTCTGACAGAACTCGAGTTCTGTCAGAGAACGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-374s1c1
Sequence:CCGGGCCCAACAGGAGTCTAATCAACTCGAGTTGATTAGACTCCTGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-789s1c1
Sequence:CCGGGCACTATCAACAATAGCCTATCTCGAGATAGGCTATTGTTGATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021953
VALIDATED
FOXM1 MISSION shRNA Lentiviral Transduction Particles
forkhead box M1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-374s21c1
Sequence:CCGGGCCCAACAGGAGTCTAATCAACTCGAGTTGATTAGACTCCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021953.2-2876s21c1
Sequence:CCGGTTGCAGGGTGGTCCGTGTAAACTCGAGTTTACACGGACCACCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-1313s21c1
Sequence:CCGGCGCCGGAACATGACCATCAAACTCGAGTTTGATGGTCATGTTCCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-2405s21c1
Sequence:CCGGGCCAATCGTTCTCTGACAGAACTCGAGTTCTGTCAGAGAACGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021953.2-1065s21c1
Sequence:CCGGAGGACCACTTTCCCTACTTTACTCGAGTAAAGTAGGGAAAGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021953.2-3186s1c1
Sequence:CCGGGCAAGAAGAAATCCTGGTTAACTCGAGTTAACCAGGATTTCTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-1313s1c1
Sequence:CCGGCGCCGGAACATGACCATCAAACTCGAGTTTGATGGTCATGTTCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-2405s1c1
Sequence:CCGGGCCAATCGTTCTCTGACAGAACTCGAGTTCTGTCAGAGAACGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-374s1c1
Sequence:CCGGGCCCAACAGGAGTCTAATCAACTCGAGTTGATTAGACTCCTGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_021953.2-789s1c1
Sequence:CCGGGCACTATCAACAATAGCCTATCTCGAGATAGGCTATTGTTGATAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks