EMAIL THIS PAGE TO A FRIEND

FOXN1

forkhead box N1

58 Gene Product Result for
Synonyms: FKHL20 RONU WHN
UniProtKB ID: O15353, B2R9Q7, O15352
Gene ID:
Human(8456) Summary: Mutations in the winged-helix transcription factor gene at the nude locus in mice and rats produce the pleiotropic phenotype of hairlessness and athymia, resulting in a severely compromised immune system. This gene is orthologous to the mouse and rat genes and encodes a similar DNA-binding transcription factor that is thought to regulate keratin gene expression. A mutation in this gene has been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing in the 5' UTR of this gene has been observed. [provided by RefSeq, Jul 2008]
Mouse(15218) forkhead box N1
Rat(287469) forkhead box N1
Zebrafish(266748) forkhead box N1
cow(516724) forkhead box N1
Horse(100059109) forkhead box N1
domestic cat(101099600) forkhead box N1
chicken(417570) forkhead box N1
dog(491168) forkhead box N1
naked mole-rat(101708703) forkhead box N1
sheep(101105170) forkhead box N1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003593 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003593 Rosetta Predictions human pricing
NM_001100648 Rosetta Predictions rat pricing
NM_008238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098012 predicted 2292
2 SASI_Hs01_00098013 predicted 455
3 SASI_Hs01_00098014 predicted 1380
4 SASI_Hs01_00098016 predicted 2282
5 SASI_Hs02_00335923 predicted 458
6 SASI_Hs01_00098017 predicted 1114
7 SASI_Hs01_00098018 predicted 965
8 SASI_Hs01_00098019 predicted 839
9 SASI_Hs01_00098020 predicted 1654
10 SASI_Hs02_00335924 predicted 1381
11 SASI_Hs01_00098015 predicted 617
12 SASI_Hs01_00098021 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210188 predicted 212
2 SASI_Rn02_00210189 predicted 908
3 SASI_Rn02_00210190 predicted 654
4 SASI_Rn02_00210191 predicted 984
5 SASI_Rn02_00210192 predicted 1614
6 SASI_Rn02_00210193 predicted 429
7 SASI_Rn02_00210194 predicted 948
8 SASI_Rn02_00210195 predicted 1423
9 SASI_Rn02_00210196 predicted 1604
10 SASI_Rn02_00210197 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170366 predicted 1060
2 SASI_Mm01_00170367 predicted 2092
3 SASI_Mm01_00170368 predicted 206
4 SASI_Mm01_00170369 predicted 1674
5 SASI_Mm01_00170370 predicted 2082
6 SASI_Mm01_00170371 predicted 520
7 SASI_Mm01_00170372 predicted 519
8 SASI_Mm01_00170373 predicted 925
9 SASI_Mm01_00170374 predicted 1081
10 SASI_Mm01_00170375 predicted 2089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008238
FOXN1 MISSION shRNA Bacterial Glycerol Stock
forkhead box N1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008238.1-2094s1c1
Sequence:CCGGCTCACCTTAAAGGTCAAAGAACTCGAGTTCTTTGACCTTTAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-520s1c1
Sequence:CCGGGCACTTGATGGACACTCCTTTCTCGAGAAAGGAGTGTCCATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-971s1c1
Sequence:CCGGCAGTCAGTGAAATCTACAATTCTCGAGAATTGTAGATTTCACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-622s1c1
Sequence:CCGGGCAGAGGCTTGGTGCAATAAACTCGAGTTTATTGCACCAAGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-970s1c1
Sequence:CCGGCCAGTCAGTGAAATCTACAATCTCGAGATTGTAGATTTCACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-655s21c1
Sequence:CCGGAGCCAGGAACACAACCAAATTCTCGAGAATTTGGTTGTGTTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-1705s21c1
Sequence:CCGGGACTTCGACTTCCAGGGAAATCTCGAGATTTCCCTGGAAGTCGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-1099s21c1
Sequence:CCGGTCCGGAAGTTCCTCTCGAAAGCTCGAGCTTTCGAGAGGAACTTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008238
FOXN1 MISSION shRNA shRNA Plasmid DNA
forkhead box N1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008238.1-2094s1c1
Sequence:CCGGCTCACCTTAAAGGTCAAAGAACTCGAGTTCTTTGACCTTTAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-520s1c1
Sequence:CCGGGCACTTGATGGACACTCCTTTCTCGAGAAAGGAGTGTCCATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-971s1c1
Sequence:CCGGCAGTCAGTGAAATCTACAATTCTCGAGAATTGTAGATTTCACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-622s1c1
Sequence:CCGGGCAGAGGCTTGGTGCAATAAACTCGAGTTTATTGCACCAAGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-970s1c1
Sequence:CCGGCCAGTCAGTGAAATCTACAATCTCGAGATTGTAGATTTCACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-655s21c1
Sequence:CCGGAGCCAGGAACACAACCAAATTCTCGAGAATTTGGTTGTGTTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-1705s21c1
Sequence:CCGGGACTTCGACTTCCAGGGAAATCTCGAGATTTCCCTGGAAGTCGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-1099s21c1
Sequence:CCGGTCCGGAAGTTCCTCTCGAAAGCTCGAGCTTTCGAGAGGAACTTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008238
FOXN1 MISSION shRNA Lentiviral Transduction Particles
forkhead box N1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008238.1-2094s1c1
Sequence:CCGGCTCACCTTAAAGGTCAAAGAACTCGAGTTCTTTGACCTTTAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-520s1c1
Sequence:CCGGGCACTTGATGGACACTCCTTTCTCGAGAAAGGAGTGTCCATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-971s1c1
Sequence:CCGGCAGTCAGTGAAATCTACAATTCTCGAGAATTGTAGATTTCACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-622s1c1
Sequence:CCGGGCAGAGGCTTGGTGCAATAAACTCGAGTTTATTGCACCAAGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008238.1-970s1c1
Sequence:CCGGCCAGTCAGTGAAATCTACAATCTCGAGATTGTAGATTTCACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-655s21c1
Sequence:CCGGAGCCAGGAACACAACCAAATTCTCGAGAATTTGGTTGTGTTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-1705s21c1
Sequence:CCGGGACTTCGACTTCCAGGGAAATCTCGAGATTTCCCTGGAAGTCGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008238.1-1099s21c1
Sequence:CCGGTCCGGAAGTTCCTCTCGAAAGCTCGAGCTTTCGAGAGGAACTTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003593
FOXN1 MISSION shRNA Bacterial Glycerol Stock
forkhead box N1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000013193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003593.2-2249s1c1
Sequence:CCGGGCTCACACTCATCCACACTTACTCGAGTAAGTGTGGATGAGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-1372s1c1
Sequence:CCGGCCTCCTGCTATGGGCAGACATCTCGAGATGTCTGCCCATAGCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-1662s1c1
Sequence:CCGGCTGTGGGAACAGTTGAAGGATCTCGAGATCCTTCAACTGTTCCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-908s1c1
Sequence:CCGGCGTCAGCGAGATCTACAATTTCTCGAGAAATTGTAGATCTCGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003593
FOXN1 MISSION shRNA shRNA Plasmid DNA
forkhead box N1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000013193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003593.2-2249s1c1
Sequence:CCGGGCTCACACTCATCCACACTTACTCGAGTAAGTGTGGATGAGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-1372s1c1
Sequence:CCGGCCTCCTGCTATGGGCAGACATCTCGAGATGTCTGCCCATAGCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-1662s1c1
Sequence:CCGGCTGTGGGAACAGTTGAAGGATCTCGAGATCCTTCAACTGTTCCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-908s1c1
Sequence:CCGGCGTCAGCGAGATCTACAATTTCTCGAGAAATTGTAGATCTCGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003593
FOXN1 MISSION shRNA Lentiviral Transduction Particles
forkhead box N1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000013193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003593.2-2249s1c1
Sequence:CCGGGCTCACACTCATCCACACTTACTCGAGTAAGTGTGGATGAGTGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-1372s1c1
Sequence:CCGGCCTCCTGCTATGGGCAGACATCTCGAGATGTCTGCCCATAGCAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-1662s1c1
Sequence:CCGGCTGTGGGAACAGTTGAAGGATCTCGAGATCCTTCAACTGTTCCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003593.2-908s1c1
Sequence:CCGGCGTCAGCGAGATCTACAATTTCTCGAGAAATTGTAGATCTCGCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks