EMAIL THIS PAGE TO A FRIEND

FOXN2

forkhead box N2

146 Gene Product Result for
Synonyms: HTLF
UniProtKB ID: P32314, Q15769, Q6P4Q2
Gene ID:
Human(3344) Summary: This gene encodes a forkhead domain binding protein and may function in the transcriptional regulation of the human T-cell leukemia virus long terminal repeat. [provided by RefSeq, Jul 2008]
Mouse(14236) forkhead box N2
Rat(301676) forkhead box N2
sheep(101106923) forkhead box N2
naked mole-rat(101710018) forkhead box N2
chicken(421288) forkhead box N2
dog(481364) forkhead box N2
Horse(100053059) forkhead box N2
cow(521742) forkhead box N2
domestic cat(101082742) forkhead box N2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_180974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_180974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_180974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002158 Rosetta Predictions human pricing
XM_001057462 Rosetta Predictions rat pricing
XM_237502 Rosetta Predictions rat pricing
NM_180974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194223 predicted 1288
2 SASI_Hs01_00194225 predicted 1091
3 SASI_Hs02_00333361 predicted 1270
4 SASI_Hs01_00194226 predicted 962
5 SASI_Hs01_00194227 predicted 1253
6 SASI_Hs01_00194228 predicted 879
7 SASI_Hs02_00333362 predicted 1289
8 SASI_Hs01_00194230 predicted 891
9 SASI_Hs01_00194231 predicted 1393
10 SASI_Hs01_00194232 predicted 1372
11 SASI_Hs01_00194224 predicted 879
12 SASI_Hs01_00194229 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286450 predicted 477
2 SASI_Rn02_00286451 predicted 261
3 SASI_Rn02_00286452 predicted 669
4 SASI_Rn02_00286453 predicted 692
5 SASI_Rn02_00286454 predicted 810
6 SASI_Rn02_00286455 predicted 679
7 SASI_Rn02_00286456 predicted 1093
8 SASI_Rn02_00286457 predicted 593
9 SASI_Rn02_00286458 predicted 229
10 SASI_Rn02_00286459 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390947 predicted 552
2 SASI_Rn02_00390948 predicted 645
3 SASI_Rn02_00390949 predicted 393
4 SASI_Rn02_00390950 predicted 671
5 SASI_Rn02_00390951 predicted 359
6 SASI_Rn02_00390952 predicted 269
7 SASI_Rn02_00390953 predicted 522
8 SASI_Rn02_00390954 predicted 754
9 SASI_Rn02_00390955 predicted 357
10 SASI_Rn02_00390956 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349585 predicted 1145
2 SASI_Mm02_00349586 predicted 1414
3 SASI_Mm02_00349587 predicted 706
4 SASI_Mm02_00349588 predicted 951
5 SASI_Mm02_00349589 predicted 746
6 SASI_Mm02_00349590 predicted 987
7 SASI_Mm01_00200373 predicted 773
8 SASI_Mm02_00349591 predicted 1285
9 SASI_Mm01_00200375 predicted 775
10 SASI_Mm02_00349592 predicted 1156
11 SASI_Mm01_00200370 predicted 1265
12 SASI_Mm01_00200371 predicted 412
13 SASI_Mm01_00200372 predicted 667
14 SASI_Mm01_00200374 predicted 780
15 SASI_Mm01_00200376 predicted 516
16 SASI_Mm01_00200377 predicted 787
17 SASI_Mm01_00200378 predicted 717
18 SASI_Mm01_00200379 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002158
FOXN2 MISSION shRNA Bacterial Glycerol Stock
forkhead box N2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-839s21c1
Sequence:CCGGGAAGCCATGGCAAGGTTAATGCTCGAGCATTAACCTTGCCATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-1167s21c1
Sequence:CCGGACGATTACAAGAGAGTGATTCCTCGAGGAATCACTCTCTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002158.3-1941s21c1
Sequence:CCGGAGATTTGGCAACTCGATAAATCTCGAGATTTATCGAGTTGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-560s21c1
Sequence:CCGGTTAGTCCATTGTATGACATAGCTCGAGCTATGTCATACAATGGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-1366s21c1
Sequence:CCGGGAAGATACAGACGTTGATTATCTCGAGATAATCAACGTCTGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-874s21c1
Sequence:CCGGTGGTGTGTTGATCCGGAATATCTCGAGATATTCCGGATCAACACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-958s21c1
Sequence:CCGGTCTTTATCACCTCACTATTTACTCGAGTAAATAGTGAGGTGATAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-1471s1c1
Sequence:CCGGCGTACATGTTTAGGTTCCCTACTCGAGTAGGGAACCTAAACATGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-484s1c1
Sequence:CCGGGTTAGTCCATTGTATGACATACTCGAGTATGTCATACAATGGACTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-931s1c1
Sequence:CCGGCGAAACCTCAAAGAATCTGATCTCGAGATCAGATTCTTTGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-303s1c1
Sequence:CCGGTGCAGGATTAAGCCAGATTTACTCGAGTAAATCTGGCTTAATCCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-892s1c1
Sequence:CCGGCCTCACTATTTAAGCTCTGTACTCGAGTACAGAGCTTAAATAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002158
FOXN2 MISSION shRNA shRNA Plasmid DNA
forkhead box N2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-839s21c1
Sequence:CCGGGAAGCCATGGCAAGGTTAATGCTCGAGCATTAACCTTGCCATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-1167s21c1
Sequence:CCGGACGATTACAAGAGAGTGATTCCTCGAGGAATCACTCTCTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002158.3-1941s21c1
Sequence:CCGGAGATTTGGCAACTCGATAAATCTCGAGATTTATCGAGTTGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-560s21c1
Sequence:CCGGTTAGTCCATTGTATGACATAGCTCGAGCTATGTCATACAATGGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-1366s21c1
Sequence:CCGGGAAGATACAGACGTTGATTATCTCGAGATAATCAACGTCTGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-874s21c1
Sequence:CCGGTGGTGTGTTGATCCGGAATATCTCGAGATATTCCGGATCAACACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-958s21c1
Sequence:CCGGTCTTTATCACCTCACTATTTACTCGAGTAAATAGTGAGGTGATAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-1471s1c1
Sequence:CCGGCGTACATGTTTAGGTTCCCTACTCGAGTAGGGAACCTAAACATGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-484s1c1
Sequence:CCGGGTTAGTCCATTGTATGACATACTCGAGTATGTCATACAATGGACTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-931s1c1
Sequence:CCGGCGAAACCTCAAAGAATCTGATCTCGAGATCAGATTCTTTGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-303s1c1
Sequence:CCGGTGCAGGATTAAGCCAGATTTACTCGAGTAAATCTGGCTTAATCCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-892s1c1
Sequence:CCGGCCTCACTATTTAAGCTCTGTACTCGAGTACAGAGCTTAAATAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002158
FOXN2 MISSION shRNA Lentiviral Transduction Particles
forkhead box N2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-839s21c1
Sequence:CCGGGAAGCCATGGCAAGGTTAATGCTCGAGCATTAACCTTGCCATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-1167s21c1
Sequence:CCGGACGATTACAAGAGAGTGATTCCTCGAGGAATCACTCTCTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002158.3-1941s21c1
Sequence:CCGGAGATTTGGCAACTCGATAAATCTCGAGATTTATCGAGTTGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-560s21c1
Sequence:CCGGTTAGTCCATTGTATGACATAGCTCGAGCTATGTCATACAATGGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-1366s21c1
Sequence:CCGGGAAGATACAGACGTTGATTATCTCGAGATAATCAACGTCTGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-874s21c1
Sequence:CCGGTGGTGTGTTGATCCGGAATATCTCGAGATATTCCGGATCAACACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002158.3-958s21c1
Sequence:CCGGTCTTTATCACCTCACTATTTACTCGAGTAAATAGTGAGGTGATAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-1471s1c1
Sequence:CCGGCGTACATGTTTAGGTTCCCTACTCGAGTAGGGAACCTAAACATGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-484s1c1
Sequence:CCGGGTTAGTCCATTGTATGACATACTCGAGTATGTCATACAATGGACTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-931s1c1
Sequence:CCGGCGAAACCTCAAAGAATCTGATCTCGAGATCAGATTCTTTGAGGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-303s1c1
Sequence:CCGGTGCAGGATTAAGCCAGATTTACTCGAGTAAATCTGGCTTAATCCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002158.2-892s1c1
Sequence:CCGGCCTCACTATTTAAGCTCTGTACTCGAGTACAGAGCTTAAATAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180974
VALIDATED
FOXN2 MISSION shRNA Bacterial Glycerol Stock
forkhead box N2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-669s21c1
Sequence:GTACCGGGGCATAATCTATCCCTGAATACTCGAGTATTCAGGGATAGATTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-710s21c1
Sequence:GTACCGGAGAAGTCATGGCAAGGTTAATCTCGAGATTAACCTTGCCATGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180974.4-3592s21c1
Sequence:CCGGCCGTGCACTCAAGACTAATAACTCGAGTTATTAGTCTTGAGTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-748s21c1
Sequence:CCGGGTGCGTTGATCCAGAATATAACTCGAGTTATATTCTGGATCAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-557s21c1
Sequence:CCGGGCTATTGAACACTCGCCAAATCTCGAGATTTGGCGAGTGTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_180974.1-955s1c1
Sequence:CCGGGCTGGGTAGTTGAGTATCAATCTCGAGATTGATACTCAACTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-512s1c1
Sequence:CCGGGCTATTGAACACTCGCCAAATCTCGAGATTTGGCGAGTGTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-344s1c1
Sequence:CCGGCTTCTAACAAACCTCAGACTTCTCGAGAAGTCTGAGGTTTGTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-713s1c1
Sequence:CCGGCCAGAATATAAGCCCAATCTTCTCGAGAAGATTGGGCTTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-625s1c1
Sequence:CCGGGCATAATCTATCCCTGAATAACTCGAGTTATTCAGGGATAGATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180974
VALIDATED
FOXN2 MISSION shRNA shRNA Plasmid DNA
forkhead box N2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-669s21c1
Sequence:GTACCGGGGCATAATCTATCCCTGAATACTCGAGTATTCAGGGATAGATTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-710s21c1
Sequence:GTACCGGAGAAGTCATGGCAAGGTTAATCTCGAGATTAACCTTGCCATGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180974.4-3592s21c1
Sequence:CCGGCCGTGCACTCAAGACTAATAACTCGAGTTATTAGTCTTGAGTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-748s21c1
Sequence:CCGGGTGCGTTGATCCAGAATATAACTCGAGTTATATTCTGGATCAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-557s21c1
Sequence:CCGGGCTATTGAACACTCGCCAAATCTCGAGATTTGGCGAGTGTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_180974.1-955s1c1
Sequence:CCGGGCTGGGTAGTTGAGTATCAATCTCGAGATTGATACTCAACTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-512s1c1
Sequence:CCGGGCTATTGAACACTCGCCAAATCTCGAGATTTGGCGAGTGTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-344s1c1
Sequence:CCGGCTTCTAACAAACCTCAGACTTCTCGAGAAGTCTGAGGTTTGTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-713s1c1
Sequence:CCGGCCAGAATATAAGCCCAATCTTCTCGAGAAGATTGGGCTTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-625s1c1
Sequence:CCGGGCATAATCTATCCCTGAATAACTCGAGTTATTCAGGGATAGATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180974
VALIDATED
FOXN2 MISSION shRNA Lentiviral Transduction Particles
forkhead box N2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-669s21c1
Sequence:GTACCGGGGCATAATCTATCCCTGAATACTCGAGTATTCAGGGATAGATTATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-710s21c1
Sequence:GTACCGGAGAAGTCATGGCAAGGTTAATCTCGAGATTAACCTTGCCATGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_180974.4-3592s21c1
Sequence:CCGGCCGTGCACTCAAGACTAATAACTCGAGTTATTAGTCTTGAGTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-748s21c1
Sequence:CCGGGTGCGTTGATCCAGAATATAACTCGAGTTATATTCTGGATCAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_180974.4-557s21c1
Sequence:CCGGGCTATTGAACACTCGCCAAATCTCGAGATTTGGCGAGTGTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_180974.1-955s1c1
Sequence:CCGGGCTGGGTAGTTGAGTATCAATCTCGAGATTGATACTCAACTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-512s1c1
Sequence:CCGGGCTATTGAACACTCGCCAAATCTCGAGATTTGGCGAGTGTTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-344s1c1
Sequence:CCGGCTTCTAACAAACCTCAGACTTCTCGAGAAGTCTGAGGTTTGTTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-713s1c1
Sequence:CCGGCCAGAATATAAGCCCAATCTTCTCGAGAAGATTGGGCTTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180974.1-625s1c1
Sequence:CCGGGCATAATCTATCCCTGAATAACTCGAGTTATTCAGGGATAGATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks