EMAIL THIS PAGE TO A FRIEND

FOXN4

forkhead box N4

51 Gene Product Result for
UniProtKB ID: Q96NZ1, Q6ZMR4, Q96NZ0
Gene ID:
Human(121643) Summary: Members of the winged-helix/forkhead family of transcription factors, such as FOXN4, are characterized by a 110-amino acid DNA-binding domain that can fold into a variant of the helix-turn-helix motif consisting of 3 alpha helices flanked by 2 large loops or wings. These transcription factors are involved in a variety of biologic processes as key regulators in development and metabolism (Li et al., 2004 [PubMed 15363391]
Mouse(116810) forkhead box N4
Rat(288736) forkhead box N4
Zebrafish(30315) forkhead box N4
chicken(416898) forkhead box N4
cow(515612) forkhead box N4
Horse(100066713) forkhead box N4
domestic cat(101086426) forkhead box N4
dog(486314) forkhead box N4
sheep(101123411) forkhead box N4
Domestic Rabbit(100338616) forkhead box N4
naked mole-rat(101710766) forkhead box N4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_062735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_062735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_062735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213596 Rosetta Predictions human pricing
NM_001105935 Rosetta Predictions rat pricing
NM_148935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020411 predicted 2095
2 SASI_Hs01_00020413 predicted 1437
3 SASI_Hs01_00020414 predicted 2035
4 SASI_Hs02_00374269 predicted 1418
5 SASI_Hs01_00020415 predicted 2062
6 SASI_Hs01_00020416 predicted 1297
7 SASI_Hs01_00020417 predicted 910
8 SASI_Hs01_00020418 predicted 1639
9 SASI_Hs02_00374270 predicted 1612
10 SASI_Hs01_00020419 predicted 1554
11 SASI_Hs01_00020412 predicted 920
12 SASI_Hs01_00020420 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213992 predicted 806
2 SASI_Rn02_00213993 predicted 1819
3 SASI_Rn02_00213994 predicted 617
4 SASI_Rn02_00213995 predicted 470
5 SASI_Rn02_00213996 predicted 1820
6 SASI_Rn02_00213997 predicted 694
7 SASI_Rn02_00213998 predicted 735
8 SASI_Rn02_00213999 predicted 1393
9 SASI_Rn02_00214000 predicted 1212
10 SASI_Rn02_00214001 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082105 predicted 566
2 SASI_Mm01_00082106 predicted 1617
3 SASI_Mm01_00082107 predicted 1941
4 SASI_Mm01_00082108 predicted 470
5 SASI_Mm01_00082109 predicted 1958
6 SASI_Mm01_00082110 predicted 2086
7 SASI_Mm01_00082111 predicted 1623
8 SASI_Mm01_00082112 predicted 942
9 SASI_Mm01_00082113 predicted 263
10 SASI_Mm01_00082114 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148935
FOXN4 MISSION shRNA Bacterial Glycerol Stock
forkhead box N4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148935.2-1845s21c1
Sequence:CCGGATGGTGAGACCCGGCTCTTAACTCGAGTTAAGAGCCGGGTCTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148935.2-2092s21c1
Sequence:CCGGTGAGACTGTGTGTACATTTATCTCGAGATAAATGTACACACAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148935.2-1525s21c1
Sequence:CCGGTGCAGGTGACAGGTCTCTATGCTCGAGCATAGAGACCTGTCACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148935.1-2127s1c1
Sequence:CCGGCCCTAGAAAGAGACCCATGTTCTCGAGAACATGGGTCTCTTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-1607s1c1
Sequence:CCGGACACCAGGGAACAAGCCTATTCTCGAGAATAGGCTTGTTCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-1306s1c1
Sequence:CCGGCTTCTCACATCACAGTGACATCTCGAGATGTCACTGTGATGTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-577s1c1
Sequence:CCGGCGGCCTCTATGGTTCTCCGTTCTCGAGAACGGAGAACCATAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-937s1c1
Sequence:CCGGGATGCACAAGTGGAAACGAAACTCGAGTTTCGTTTCCACTTGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148935
FOXN4 MISSION shRNA shRNA Plasmid DNA
forkhead box N4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148935.2-1845s21c1
Sequence:CCGGATGGTGAGACCCGGCTCTTAACTCGAGTTAAGAGCCGGGTCTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148935.2-2092s21c1
Sequence:CCGGTGAGACTGTGTGTACATTTATCTCGAGATAAATGTACACACAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148935.2-1525s21c1
Sequence:CCGGTGCAGGTGACAGGTCTCTATGCTCGAGCATAGAGACCTGTCACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148935.1-2127s1c1
Sequence:CCGGCCCTAGAAAGAGACCCATGTTCTCGAGAACATGGGTCTCTTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-1607s1c1
Sequence:CCGGACACCAGGGAACAAGCCTATTCTCGAGAATAGGCTTGTTCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-1306s1c1
Sequence:CCGGCTTCTCACATCACAGTGACATCTCGAGATGTCACTGTGATGTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-577s1c1
Sequence:CCGGCGGCCTCTATGGTTCTCCGTTCTCGAGAACGGAGAACCATAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-937s1c1
Sequence:CCGGGATGCACAAGTGGAAACGAAACTCGAGTTTCGTTTCCACTTGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148935
FOXN4 MISSION shRNA Lentiviral Transduction Particles
forkhead box N4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148935.2-1845s21c1
Sequence:CCGGATGGTGAGACCCGGCTCTTAACTCGAGTTAAGAGCCGGGTCTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148935.2-2092s21c1
Sequence:CCGGTGAGACTGTGTGTACATTTATCTCGAGATAAATGTACACACAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148935.2-1525s21c1
Sequence:CCGGTGCAGGTGACAGGTCTCTATGCTCGAGCATAGAGACCTGTCACCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148935.1-2127s1c1
Sequence:CCGGCCCTAGAAAGAGACCCATGTTCTCGAGAACATGGGTCTCTTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-1607s1c1
Sequence:CCGGACACCAGGGAACAAGCCTATTCTCGAGAATAGGCTTGTTCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-1306s1c1
Sequence:CCGGCTTCTCACATCACAGTGACATCTCGAGATGTCACTGTGATGTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-577s1c1
Sequence:CCGGCGGCCTCTATGGTTCTCCGTTCTCGAGAACGGAGAACCATAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148935.1-937s1c1
Sequence:CCGGGATGCACAAGTGGAAACGAAACTCGAGTTTCGTTTCCACTTGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_062735
FOXN4 MISSION shRNA Bacterial Glycerol Stock
forkhead box N4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-1290s1c1
Sequence:CCGGCAACATCAGCACCGACATGAACTCGAGTTCATGTCGGTGCTGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-1329s1c1
Sequence:CCGGCGACCCGAGCATCATGGACTTCTCGAGAAGTCCATGATGCTCGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-96s1c1
Sequence:CCGGGCTATCCTACATCCACTACAACTCGAGTTGTAGTGGATGTAGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-651s1c1
Sequence:CCGGCTACTCGTACAGCTGTCTGATCTCGAGATCAGACAGCTGTACGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-105s1c1
Sequence:CCGGCATCCACTACAACCGATGTTTCTCGAGAAACATCGGTTGTAGTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_062735
FOXN4 MISSION shRNA shRNA Plasmid DNA
forkhead box N4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-1290s1c1
Sequence:CCGGCAACATCAGCACCGACATGAACTCGAGTTCATGTCGGTGCTGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-1329s1c1
Sequence:CCGGCGACCCGAGCATCATGGACTTCTCGAGAAGTCCATGATGCTCGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-96s1c1
Sequence:CCGGGCTATCCTACATCCACTACAACTCGAGTTGTAGTGGATGTAGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-651s1c1
Sequence:CCGGCTACTCGTACAGCTGTCTGATCTCGAGATCAGACAGCTGTACGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-105s1c1
Sequence:CCGGCATCCACTACAACCGATGTTTCTCGAGAAACATCGGTTGTAGTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_062735
FOXN4 MISSION shRNA Lentiviral Transduction Particles
forkhead box N4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-1290s1c1
Sequence:CCGGCAACATCAGCACCGACATGAACTCGAGTTCATGTCGGTGCTGATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-1329s1c1
Sequence:CCGGCGACCCGAGCATCATGGACTTCTCGAGAAGTCCATGATGCTCGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-96s1c1
Sequence:CCGGGCTATCCTACATCCACTACAACTCGAGTTGTAGTGGATGTAGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-651s1c1
Sequence:CCGGCTACTCGTACAGCTGTCTGATCTCGAGATCAGACAGCTGTACGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_062735.7-105s1c1
Sequence:CCGGCATCCACTACAACCGATGTTTCTCGAGAAACATCGGTTGTAGTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks