EMAIL THIS PAGE TO A FRIEND

FOXO1

forkhead box O1

200 Gene Product Result for
Synonyms: FKH1 FKHR FOXO1A
UniProtKB ID: Q12778, O43523, Q5VYC7, Q6NSK6
Gene ID:
Human(2308) Summary: This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in myogenic growth and differentiation. Translocation of this gene with PAX3 has been associated with alveolar rhabdomyosarcoma. [provided by RefSeq, Jul 2008]
Mouse(56458) forkhead box O1
Rat(84482) forkhead box O1
chicken(374231) forkhead box O1
dog(477295) forkhead box O1
domestic cat(101096628) forkhead box O1
cow(506618) forkhead box O1
Horse(100050481) forkhead box O1
naked mole-rat(101707441) forkhead box O1
sheep(101107877) forkhead box O1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306343 ANTI-FKHR (CENTER D469) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
F2303 Anti-FKHR (FOXO1a) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
SAB4500938 Anti-FKHR antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500939 Anti-FKHR antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300410 Anti-FOXO1 (Ab-256) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300428 Anti-FOXO1 (Ab-319) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
AV100607 Anti-FOXO1 (AB1) antibody produced in rabbit affinity isolated antibody zebrafish, pig, mouse, bovine, canine, human, rat
western blot pricing
AV32107 Anti-FOXO1 (AB2) antibody produced in rabbit affinity isolated antibody horse, bovine, pig, rat, canine, human, mouse, rabbit, zebrafish, guinea pig
western blot pricing
AV32976 Anti-FOXO1 (AB3) antibody produced in rabbit affinity isolated antibody canine, rat, guinea pig, pig, human, bovine, mouse, horse, rabbit
western blot pricing
SAB2500417 Anti-FOXO1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA001252 Anti-FOXO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry pricing
SAB3500507 Anti-FOXO1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB4500935 Anti-FOXO1, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB1411790 ANTI-FOXO1A antibody produced in mouse clone 4B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411812 ANTI-FOXO1A antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411813 ANTI-FOXO1A antibody produced in mouse clone 4A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411814 ANTI-FOXO1A antibody produced in mouse clone 4A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411815 ANTI-FOXO1A antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411857 ANTI-FOXO1A antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411858 ANTI-FOXO1A antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411859 ANTI-FOXO1A antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411860 ANTI-FOXO1A antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411861 ANTI-FOXO1A antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV38094 Anti-FOXO1A antibody produced in rabbit IgG fraction of antiserum pig, canine, bovine, human
western blot pricing
SAB4500936 Anti-FOXO1A antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500937 Anti-FOXO1A antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4504407 Anti-phospho-FKHR (pSer256) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504408 Anti-phospho-FKHR (pSer319) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300094 Anti-phospho-FOXO1 (pSer256) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300112 Anti-phospho-FOXO1 (pSer319) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503917 Anti-phospho-FOXO1/3/4-pan (pThr24/32) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503918 Anti-phospho-FOXO1A (pSer329) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301576 Anti-phospho-FOXO1A (pSer329) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4503919 Anti-phospho-FOXO1A/3A (pSer322+Ser325) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
F6928 Monoclonal Anti-FKHR (FOXO1a) antibody produced in mouse clone FKH 117, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation, microarray, western blot pricing
WH0002308M12 Monoclonal Anti-FOXO1A antibody produced in mouse clone 3A10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403828 Monoclonal Anti-FOXO1A, (C-terminal) antibody produced in mouse clone 4E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0084 Rabbit anti-FOXO1a Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, rat, pig, horse, primate, bovine, chimpanzee, dog, rhesus monkey, human, mouse
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002015 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156591 MISSION® esiRNA esiRNA human FOXO1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002015 Rosetta Predictions human pricing
XM_001056726 Rosetta Predictions rat pricing
XM_342244 Rosetta Predictions rat pricing
NM_019739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076732 predicted 1009
2 SASI_Hs01_00076733 predicted 1743
3 SASI_Hs01_00076734 predicted 1435
4 SASI_Hs01_00076735 predicted 1878
5 SASI_Hs01_00076736 predicted 1731
6 SASI_Hs01_00076738 predicted 1867
7 SASI_Hs01_00076739 predicted 1532
8 SASI_Hs01_00076740 predicted 2175
9 SASI_Hs01_00076741 predicted 1121
10 SASI_Hs02_00333016 predicted 1608
11 SASI_Hs01_00076737 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284211 predicted 1642
2 SASI_Rn02_00284212 predicted 1112
3 SASI_Rn02_00284213 predicted 1752
4 SASI_Rn02_00284214 predicted 1075
5 SASI_Rn02_00284215 predicted 2228
6 SASI_Rn02_00284216 predicted 1588
7 SASI_Rn02_00284217 predicted 646
8 SASI_Rn02_00284218 predicted 1782
9 SASI_Rn02_00284219 predicted 1696
10 SASI_Rn02_00284220 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393997 predicted 1650
2 SASI_Rn02_00393998 predicted 1114
3 SASI_Rn02_00393999 predicted 1755
4 SASI_Rn02_00394000 predicted 1074
5 SASI_Rn02_00394001 predicted 2225
6 SASI_Rn02_00394002 predicted 1589
7 SASI_Rn02_00394003 predicted 655
8 SASI_Rn02_00394004 predicted 1781
9 SASI_Rn02_00394005 predicted 1700
10 SASI_Rn02_00394006 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046446 predicted 1629
2 SASI_Mm01_00046447 predicted 2210
3 SASI_Mm01_00046448 predicted 1745
4 SASI_Mm01_00046450 predicted 1646
5 SASI_Mm01_00046455 predicted 626
6 SASI_Mm01_00046451 predicted 1760
7 SASI_Mm01_00046452 predicted 1568
8 SASI_Mm01_00046453 predicted 1913
9 SASI_Mm01_00046454 predicted 1899
10 SASI_Mm01_00046449 predicted 1762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002015
FOXO1 MISSION shRNA Bacterial Glycerol Stock
forkhead box O1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000010333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.x-940s1c1
Sequence:CCGGATCTACGAGTGGATGGTCAACTCGAGTTGACCATCCACTCGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.2-472s1c1
Sequence:CCGGGCCGGAGTTTAGCCAGTCCAACTCGAGTTGGACTGGCTAAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.2-1609s1c1
Sequence:CCGGGCCACCAAACACCAGTTTGAACTCGAGTTCAAACTGGTGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002015
FOXO1 MISSION shRNA shRNA Plasmid DNA
forkhead box O1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000010333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.x-940s1c1
Sequence:CCGGATCTACGAGTGGATGGTCAACTCGAGTTGACCATCCACTCGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.2-472s1c1
Sequence:CCGGGCCGGAGTTTAGCCAGTCCAACTCGAGTTGGACTGGCTAAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.2-1609s1c1
Sequence:CCGGGCCACCAAACACCAGTTTGAACTCGAGTTCAAACTGGTGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002015
FOXO1 MISSION shRNA Lentiviral Transduction Particles
forkhead box O1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000010333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.x-940s1c1
Sequence:CCGGATCTACGAGTGGATGGTCAACTCGAGTTGACCATCCACTCGTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.2-472s1c1
Sequence:CCGGGCCGGAGTTTAGCCAGTCCAACTCGAGTTGGACTGGCTAAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002015.2-1609s1c1
Sequence:CCGGGCCACCAAACACCAGTTTGAACTCGAGTTCAAACTGGTGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019739
VALIDATED
FOXO1 MISSION shRNA Bacterial Glycerol Stock
forkhead box O1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-1766s1c1
Sequence:CCGGCGGAGGATTGAACCAGTATAACTCGAGTTATACTGGTTCAATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019739.2-1187s1c1
Sequence:CCGGCATGGACAACAACAGTAAATTCTCGAGAATTTACTGTTGTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-1644s1c1
Sequence:CCGGCCGCCAAACACCAGTCTAAATCTCGAGATTTAGACTGGTGTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-2088s1c1
Sequence:CCGGCCCGTGAAGACACCTTTACAACTCGAGTTGTAAAGGTGTCTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019739.2-1904s21c1
Sequence:CCGGTGTAATGATGGGCCCTAATTCCTCGAGGAATTAGGGCCCATCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019739.2-1187s21c1
Sequence:CCGGCATGGACAACAACAGTAAATTCTCGAGAATTTACTGTTGTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-1766s21c1
Sequence:CCGGCGGAGGATTGAACCAGTATAACTCGAGTTATACTGGTTCAATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-1668s21c1
Sequence:CCGGCCCAGTCCAAACTACTCAAAGCTCGAGCTTTGAGTAGTTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-3909s21c1
Sequence:CCGGTGGAAACCAGCCAGCTATAAACTCGAGTTTATAGCTGGCTGGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019739
VALIDATED
FOXO1 MISSION shRNA shRNA Plasmid DNA
forkhead box O1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-1766s1c1
Sequence:CCGGCGGAGGATTGAACCAGTATAACTCGAGTTATACTGGTTCAATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019739.2-1187s1c1
Sequence:CCGGCATGGACAACAACAGTAAATTCTCGAGAATTTACTGTTGTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-1644s1c1
Sequence:CCGGCCGCCAAACACCAGTCTAAATCTCGAGATTTAGACTGGTGTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-2088s1c1
Sequence:CCGGCCCGTGAAGACACCTTTACAACTCGAGTTGTAAAGGTGTCTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019739.2-1904s21c1
Sequence:CCGGTGTAATGATGGGCCCTAATTCCTCGAGGAATTAGGGCCCATCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019739.2-1187s21c1
Sequence:CCGGCATGGACAACAACAGTAAATTCTCGAGAATTTACTGTTGTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-1766s21c1
Sequence:CCGGCGGAGGATTGAACCAGTATAACTCGAGTTATACTGGTTCAATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-1668s21c1
Sequence:CCGGCCCAGTCCAAACTACTCAAAGCTCGAGCTTTGAGTAGTTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-3909s21c1
Sequence:CCGGTGGAAACCAGCCAGCTATAAACTCGAGTTTATAGCTGGCTGGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019739
VALIDATED
FOXO1 MISSION shRNA Lentiviral Transduction Particles
forkhead box O1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-1766s1c1
Sequence:CCGGCGGAGGATTGAACCAGTATAACTCGAGTTATACTGGTTCAATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019739.2-1187s1c1
Sequence:CCGGCATGGACAACAACAGTAAATTCTCGAGAATTTACTGTTGTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-1644s1c1
Sequence:CCGGCCGCCAAACACCAGTCTAAATCTCGAGATTTAGACTGGTGTTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019739.2-2088s1c1
Sequence:CCGGCCCGTGAAGACACCTTTACAACTCGAGTTGTAAAGGTGTCTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019739.2-1904s21c1
Sequence:CCGGTGTAATGATGGGCCCTAATTCCTCGAGGAATTAGGGCCCATCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019739.2-1187s21c1
Sequence:CCGGCATGGACAACAACAGTAAATTCTCGAGAATTTACTGTTGTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-1766s21c1
Sequence:CCGGCGGAGGATTGAACCAGTATAACTCGAGTTATACTGGTTCAATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-1668s21c1
Sequence:CCGGCCCAGTCCAAACTACTCAAAGCTCGAGCTTTGAGTAGTTTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019739.2-3909s21c1
Sequence:CCGGTGGAAACCAGCCAGCTATAAACTCGAGTTTATAGCTGGCTGGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks