EMAIL THIS PAGE TO A FRIEND

FOXO3

forkhead box O3

Synonyms: AF6q21 FKHRL1 FKHRL1P2 FOXO2 FOXO3A
UniProtKB ID: O43524, E1P5E6, O15171, Q5T2I7, Q9BZ04
Gene ID:
Human(2309) Summary: This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. This gene likely functions as a trigger for apoptosis through expression of genes necessary for cell death. Translocation of this gene with the MLL gene is associated with secondary acute leukemia. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(56484) forkhead box O3
Rat(294515) forkhead box O3
chicken(421769) forkhead box O3
domestic cat(101081548) forkhead box O3
cow(535530) forkhead box O3
Horse(100066558) forkhead box O3
dog(481954) forkhead box O3
sheep(100913151) forkhead box O3
naked mole-rat(101699251) forkhead box O3
161 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F2178 Anti-FKHRL1 (FOXO3a) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, microarray, western blot pricing
SAB4500941 Anti-FKHRL1 antibody produced in rabbit affinity isolated antibody mouse, human
pricing
SAB2107951 Anti-FOXO3 antibody produced in rabbit affinity isolated antibody rat, rabbit, canine, zebrafish, pig, mouse, bovine, guinea pig, human, sheep
western blot pricing
AV38040 Anti-FOXO3 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, bovine, canine, mouse, human, pig
western blot pricing
SAB3500508 Anti-FOXO3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
HPA063104 Anti-FOXO3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1411796 ANTI-FOXO3A antibody produced in mouse clone 3F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411797 ANTI-FOXO3A antibody produced in mouse clone 2H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411798 ANTI-FOXO3A antibody produced in mouse clone 1D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411799 ANTI-FOXO3A antibody produced in mouse clone 2C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411800 ANTI-FOXO3A antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411801 ANTI-FOXO3A antibody produced in mouse clone 4E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411802 ANTI-FOXO3A antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411803 ANTI-FOXO3A antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411806 ANTI-FOXO3A antibody produced in mouse clone 4F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411820 ANTI-FOXO3A antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV38041 Anti-FOXO3A antibody produced in rabbit affinity isolated antibody canine, sheep, horse, mouse, human, rat, pig, guinea pig, rabbit
western blot pricing
SAB2500418 Anti-FOXO3A/FKHRL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, canine, mouse
ELISA, western blot pricing
SAB4504409 Anti-phospho-FKHRL1 (pSer253) antibody produced in rabbit affinity isolated antibody human, rat, mouse
pricing
F1304 Monoclonal Anti-FKHRL1 (FOXO3a) antibody produced in mouse clone FR1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, microarray, western blot pricing
WH0002309M3 Monoclonal Anti-FOXO3A antibody produced in mouse clone 1F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403829 Monoclonal Anti-FOXO3A antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
PLA0107 Rabbit anti-FOXO3a Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, sheep, dog, primate, rhesus monkey, gorilla, mouse, human, horse, pig, chimpanzee
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001455 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001455 Rosetta Predictions human pricing
NM_201559 Rosetta Predictions human pricing
NM_001106395 Rosetta Predictions rat pricing
NM_019740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119127 predicted 1471
2 SASI_Hs01_00119128 predicted 989
3 SASI_Hs01_00119129 predicted 1168
4 SASI_Hs01_00119130 predicted 994
5 SASI_Hs01_00119131 predicted 1917
6 SASI_Hs01_00119132 predicted 1766
7 SASI_Hs02_00331890 predicted 2410
8 SASI_Hs01_00119133 predicted 1913
9 SASI_Hs02_00331891 predicted 2459
10 SASI_Hs01_00119134 predicted 1442
11 SASI_Hs01_00119126 predicted 1660
12 SASI_Hs01_00119135 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161590 predicted 1445
2 SASI_Hs01_00161591 predicted 963
3 SASI_Hs01_00161592 predicted 1141
4 SASI_Hs01_00161593 predicted 964
5 SASI_Hs01_00161594 predicted 1890
6 SASI_Hs01_00161595 predicted 1742
7 SASI_Hs02_00373051 predicted 2378
8 SASI_Hs01_00161596 predicted 1888
9 SASI_Hs02_00373052 predicted 2431
10 SASI_Hs01_00161597 predicted 1417
11 SASI_Hs01_00161589 predicted 1630
12 SASI_Hs01_00161598 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218538 predicted 2558
2 SASI_Rn02_00218539 predicted 1989
3 SASI_Rn02_00218540 predicted 973
4 SASI_Rn02_00218541 predicted 2374
5 SASI_Rn02_00218542 predicted 2566
6 SASI_Rn02_00218543 predicted 859
7 SASI_Rn02_00218544 predicted 1434
8 SASI_Rn02_00218545 predicted 2460
9 SASI_Rn02_00218546 predicted 2096
10 SASI_Rn02_00218547 predicted 2454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324883 predicted 2410
2 SASI_Mm02_00324884 predicted 1620
3 SASI_Mm01_00181437 predicted 1628
4 SASI_Mm02_00324885 predicted 851
5 SASI_Mm01_00181442 predicted 1666
6 SASI_Mm01_00181445 predicted 1981
7 SASI_Mm02_00324886 predicted 2363
8 SASI_Mm02_00324887 predicted 2268
9 SASI_Mm02_00324888 predicted 856
10 SASI_Mm02_00324889 predicted 2086
11 SASI_Mm01_00181438 predicted 1829
12 SASI_Mm01_00181439 predicted 1436
13 SASI_Mm01_00181440 predicted 1434
14 SASI_Mm01_00181441 predicted 1840
15 SASI_Mm01_00181443 predicted 2160
16 SASI_Mm01_00181444 predicted 1721
17 SASI_Mm01_00181446 predicted 1725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019740
VALIDATED
FOXO3 MISSION shRNA Bacterial Glycerol Stock
forkhead box O3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-2438s21c1
Sequence:CCGGAGTGGACAGTGATCCGTTTACCTCGAGGTAAACGGATCACTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-2543s21c1
Sequence:CCGGCCGTGGAACAGAACTCTATAACTCGAGTTATAGAGTTCTGTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1624s21c1
Sequence:CCGGGTTTGGACCTTCGTCTCTGAACTCGAGTTCAGAGACGAAGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1440s21c1
Sequence:CCGGCCGGCACCATGAATCTGAATGCTCGAGCATTCAGATTCATGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1960s21c1
Sequence:CCGGCAGCCGTGCCTTGTCAAATTCCTCGAGGAATTTGACAAGGCACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019740.1-1441s1c1
Sequence:CCGGCGGCACCATGAATCTGAATGACTCGAGTCATTCAGATTCATGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-841s1c1
Sequence:CCGGCCCGGACAAACGGCTCACTTTCTCGAGAAAGTGAGCCGTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-1852s1c1
Sequence:CCGGGCTTCGCAACGATCCAATGATCTCGAGATCATTGGATCGTTGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-2195s1c1
Sequence:CCGGGAGTCCATCATCCGTAGTGAACTCGAGTTCACTACGGATGATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019740.1-1624s1c1
Sequence:CCGGGTTTGGACCTTCGTCTCTGAACTCGAGTTCAGAGACGAAGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019740
VALIDATED
FOXO3 MISSION shRNA shRNA Plasmid DNA
forkhead box O3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-2438s21c1
Sequence:CCGGAGTGGACAGTGATCCGTTTACCTCGAGGTAAACGGATCACTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-2543s21c1
Sequence:CCGGCCGTGGAACAGAACTCTATAACTCGAGTTATAGAGTTCTGTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1624s21c1
Sequence:CCGGGTTTGGACCTTCGTCTCTGAACTCGAGTTCAGAGACGAAGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1440s21c1
Sequence:CCGGCCGGCACCATGAATCTGAATGCTCGAGCATTCAGATTCATGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1960s21c1
Sequence:CCGGCAGCCGTGCCTTGTCAAATTCCTCGAGGAATTTGACAAGGCACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019740.1-1441s1c1
Sequence:CCGGCGGCACCATGAATCTGAATGACTCGAGTCATTCAGATTCATGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-841s1c1
Sequence:CCGGCCCGGACAAACGGCTCACTTTCTCGAGAAAGTGAGCCGTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-1852s1c1
Sequence:CCGGGCTTCGCAACGATCCAATGATCTCGAGATCATTGGATCGTTGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-2195s1c1
Sequence:CCGGGAGTCCATCATCCGTAGTGAACTCGAGTTCACTACGGATGATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019740.1-1624s1c1
Sequence:CCGGGTTTGGACCTTCGTCTCTGAACTCGAGTTCAGAGACGAAGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019740
VALIDATED
FOXO3 MISSION shRNA Lentiviral Transduction Particles
forkhead box O3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-2438s21c1
Sequence:CCGGAGTGGACAGTGATCCGTTTACCTCGAGGTAAACGGATCACTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-2543s21c1
Sequence:CCGGCCGTGGAACAGAACTCTATAACTCGAGTTATAGAGTTCTGTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1624s21c1
Sequence:CCGGGTTTGGACCTTCGTCTCTGAACTCGAGTTCAGAGACGAAGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1440s21c1
Sequence:CCGGCCGGCACCATGAATCTGAATGCTCGAGCATTCAGATTCATGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019740.2-1960s21c1
Sequence:CCGGCAGCCGTGCCTTGTCAAATTCCTCGAGGAATTTGACAAGGCACGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019740.1-1441s1c1
Sequence:CCGGCGGCACCATGAATCTGAATGACTCGAGTCATTCAGATTCATGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-841s1c1
Sequence:CCGGCCCGGACAAACGGCTCACTTTCTCGAGAAAGTGAGCCGTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-1852s1c1
Sequence:CCGGGCTTCGCAACGATCCAATGATCTCGAGATCATTGGATCGTTGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019740.1-2195s1c1
Sequence:CCGGGAGTCCATCATCCGTAGTGAACTCGAGTTCACTACGGATGATGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019740.1-1624s1c1
Sequence:CCGGGTTTGGACCTTCGTCTCTGAACTCGAGTTCAGAGACGAAGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001455
VALIDATED
FOXO3 MISSION shRNA Bacterial Glycerol Stock
forkhead box O3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1105s21c1
Sequence:CCGGGGACAATAGCAACAAGTATACCTCGAGGTATACTTGTTGCTATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1267s21c1
Sequence:CCGGCTTCCGTTCACGCACCAATTCCTCGAGGAATTGGTGCGTGAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001455.3-6977s21c1
Sequence:CCGGCTTGCTCATATCCCATATAATCTCGAGATTATATGGGATATGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1573s21c1
Sequence:CCGGGAGCTCTAGCTTCCCGTATACCTCGAGGTATACGGGAAGCTAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-2206s21c1
Sequence:CCGGATGTGACATGGAGTCCATTATCTCGAGATAATGGACTCCATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-1566s1c1
Sequence:CCGGGTCACTGCATAGTCGATTCATCTCGAGATGAATCGACTATGCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-2208s1c1
Sequence:CCGGCTCCTTTAACAGCACGGTGTTCTCGAGAACACCGTGCTGTTAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-2864s1c1
Sequence:CCGGCCACACAGAATGTTGTTGGTTCTCGAGAACCAACAACATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001455.1-2978s1c1
Sequence:CCGGCAGACCCTCAAACTGACACAACTCGAGTTGTGTCAGTTTGAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001455.x-2766s1c1
Sequence:CCGGCATGTTCAATGGGAGCTTGGACTCGAGTCCAAGCTCCCATTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.x-1687s1c1
Sequence:CCGGACAATAGCAACAAGTATACCCTCGAGGGTATACTTGTTGCTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001455
VALIDATED
FOXO3 MISSION shRNA shRNA Plasmid DNA
forkhead box O3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1105s21c1
Sequence:CCGGGGACAATAGCAACAAGTATACCTCGAGGTATACTTGTTGCTATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1267s21c1
Sequence:CCGGCTTCCGTTCACGCACCAATTCCTCGAGGAATTGGTGCGTGAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001455.3-6977s21c1
Sequence:CCGGCTTGCTCATATCCCATATAATCTCGAGATTATATGGGATATGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1573s21c1
Sequence:CCGGGAGCTCTAGCTTCCCGTATACCTCGAGGTATACGGGAAGCTAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-2206s21c1
Sequence:CCGGATGTGACATGGAGTCCATTATCTCGAGATAATGGACTCCATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-1566s1c1
Sequence:CCGGGTCACTGCATAGTCGATTCATCTCGAGATGAATCGACTATGCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-2208s1c1
Sequence:CCGGCTCCTTTAACAGCACGGTGTTCTCGAGAACACCGTGCTGTTAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-2864s1c1
Sequence:CCGGCCACACAGAATGTTGTTGGTTCTCGAGAACCAACAACATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001455.1-2978s1c1
Sequence:CCGGCAGACCCTCAAACTGACACAACTCGAGTTGTGTCAGTTTGAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001455.x-2766s1c1
Sequence:CCGGCATGTTCAATGGGAGCTTGGACTCGAGTCCAAGCTCCCATTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.x-1687s1c1
Sequence:CCGGACAATAGCAACAAGTATACCCTCGAGGGTATACTTGTTGCTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001455
VALIDATED
FOXO3 MISSION shRNA Lentiviral Transduction Particles
forkhead box O3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1105s21c1
Sequence:CCGGGGACAATAGCAACAAGTATACCTCGAGGTATACTTGTTGCTATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1267s21c1
Sequence:CCGGCTTCCGTTCACGCACCAATTCCTCGAGGAATTGGTGCGTGAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001455.3-6977s21c1
Sequence:CCGGCTTGCTCATATCCCATATAATCTCGAGATTATATGGGATATGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-1573s21c1
Sequence:CCGGGAGCTCTAGCTTCCCGTATACCTCGAGGTATACGGGAAGCTAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001455.3-2206s21c1
Sequence:CCGGATGTGACATGGAGTCCATTATCTCGAGATAATGGACTCCATGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-1566s1c1
Sequence:CCGGGTCACTGCATAGTCGATTCATCTCGAGATGAATCGACTATGCAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-2208s1c1
Sequence:CCGGCTCCTTTAACAGCACGGTGTTCTCGAGAACACCGTGCTGTTAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.1-2864s1c1
Sequence:CCGGCCACACAGAATGTTGTTGGTTCTCGAGAACCAACAACATTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001455.1-2978s1c1
Sequence:CCGGCAGACCCTCAAACTGACACAACTCGAGTTGTGTCAGTTTGAGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001455.x-2766s1c1
Sequence:CCGGCATGTTCAATGGGAGCTTGGACTCGAGTCCAAGCTCCCATTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001455.x-1687s1c1
Sequence:CCGGACAATAGCAACAAGTATACCCTCGAGGGTATACTTGTTGCTATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks