EMAIL THIS PAGE TO A FRIEND

FOXO4

forkhead box O4

154 Gene Product Result for
Synonyms: AFX AFX1 MLLT7
UniProtKB ID: P98177, B7WPJ7, O43821, Q13720, Q3KPF1, Q8TDK9
Gene ID:
Human(4303) Summary: This gene encodes a member of the O class of winged helix/forkhead transcription factor family. Proteins encoded by this class are regulated by factors involved in growth and differentiation indicating they play a role in these processes. A translocation involving this gene on chromosome X and the homolog of the Drosophila trithorax gene, encoding a DNA binding protein, located on chromosome 11 is associated with leukemia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(54601) forkhead box O4
Rat(302415) forkhead box O4
chicken(428703) forkhead box O4
domestic cat(101089987) forkhead box O4
Horse(100055869) forkhead box O4
cow(618793) forkhead box O4
dog(491946) forkhead box O4
naked mole-rat(101714065) forkhead box O4
sheep(101103040) forkhead box O4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5854 Anti-AFX (FOXO4) antibody, Mouse monoclonal clone AF3.10, purified from hybridoma cell culture human
ELISA, immunocytochemistry, microarray, western blot pricing
A8975 Anti-AFX antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
SAB4501888 Anti-AFX antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300429 Anti-FOXO4 (Ab-197) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2100854 Anti-FOXO4 antibody produced in rabbit affinity isolated antibody mouse, horse, human, canine, rat
western blot pricing
SAB3500509 Anti-FOXO4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunocytochemistry, western blot pricing
SAB3500510 Anti-FOXO4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, western blot pricing
HPA040232 Anti-FOXO4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106447 Anti-FOXO4 antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, rabbit, human
ELISA, western blot pricing
HPA039560 Anti-FOXO4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4501887 Anti-FOXO4, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, western blot pricing
SAB2500419 Anti-FOXO4/MLLT7 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1306690 ANTI-MLLT7(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4504410 Anti-phospho-AFX (pSer197) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503917 Anti-phospho-FOXO1/3/4-pan (pThr24/32) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4300113 Anti-phospho-FOXO4 (pSer197) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504584 Anti-phospho-FOXO4 (pSer262) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504279 Anti-phospho-FOXO4 (pThr451) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301549 Anti-phospho-FOXO4 (pThr451) antibody produced in rabbit affinity isolated antibody human
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1467 Human FOXO4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005938 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005938 Rosetta Predictions human pricing
NM_001106943 Rosetta Predictions rat pricing
NM_018789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205008 predicted 2176
2 SASI_Hs01_00205009 predicted 1486
3 SASI_Hs01_00205011 predicted 2156
4 SASI_Hs02_00340599 predicted 2270
5 SASI_Hs01_00205012 predicted 1839
6 SASI_Hs01_00205013 predicted 1295
7 SASI_Hs01_00205014 predicted 1631
8 SASI_Hs01_00205015 predicted 1987
9 SASI_Hs01_00205016 predicted 659
10 SASI_Hs01_00205017 predicted 1200
11 SASI_Hs01_00205010 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223936 predicted 1789
2 SASI_Rn02_00223937 predicted 621
3 SASI_Rn02_00223938 predicted 889
4 SASI_Rn02_00223939 predicted 444
5 SASI_Rn02_00223940 predicted 463
6 SASI_Rn02_00223941 predicted 597
7 SASI_Rn02_00223942 predicted 922
8 SASI_Rn02_00223943 predicted 1182
9 SASI_Rn02_00223944 predicted 1799
10 SASI_Rn02_00223945 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073416 predicted 770
2 SASI_Mm01_00073417 predicted 1343
3 SASI_Mm01_00073418 predicted 1035
4 SASI_Mm01_00073419 predicted 1118
5 SASI_Mm01_00073421 predicted 601
6 SASI_Mm01_00073422 predicted 1108
7 SASI_Mm01_00073424 predicted 755
8 SASI_Mm01_00073425 predicted 1579
9 SASI_Mm02_00324101 predicted 1324
10 SASI_Mm02_00324102 predicted 1368
11 SASI_Mm01_00073420 predicted 1198
12 SASI_Mm01_00073423 predicted 1707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018789
FOXO4 MISSION shRNA Bacterial Glycerol Stock
forkhead box O4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1785s1c1
Sequence:CCGGGACTTCAACTTTGAGCCAGATCTCGAGATCTGGCTCAAAGTTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-779s1c1
Sequence:CCGGCAAGTTCATCAAGGTTCACAACTCGAGTTGTGAACCTTGATGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1701s1c1
Sequence:CCGGGATCTGGATCTTGATATGTATCTCGAGATACATATCAAGATCCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-330s1c1
Sequence:CCGGGCCGCGATCCTAGACCTCGATCTCGAGATCGAGGTCTAGGATCGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1334s1c1
Sequence:CCGGTGGCCCAATAGATGGGTCTTTCTCGAGAAAGACCCATCTATTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018789.2-2150s21c1
Sequence:CCGGAGTCACCAGTGGCCTTATTACCTCGAGGTAATAAGGCCACTGGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018789.2-1945s21c1
Sequence:CCGGACTCAAGTGTTGAGGAAATTACTCGAGTAATTTCCTCAACACTTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018789.2-1062s21c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018789
FOXO4 MISSION shRNA shRNA Plasmid DNA
forkhead box O4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1785s1c1
Sequence:CCGGGACTTCAACTTTGAGCCAGATCTCGAGATCTGGCTCAAAGTTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-779s1c1
Sequence:CCGGCAAGTTCATCAAGGTTCACAACTCGAGTTGTGAACCTTGATGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1701s1c1
Sequence:CCGGGATCTGGATCTTGATATGTATCTCGAGATACATATCAAGATCCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-330s1c1
Sequence:CCGGGCCGCGATCCTAGACCTCGATCTCGAGATCGAGGTCTAGGATCGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1334s1c1
Sequence:CCGGTGGCCCAATAGATGGGTCTTTCTCGAGAAAGACCCATCTATTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018789.2-2150s21c1
Sequence:CCGGAGTCACCAGTGGCCTTATTACCTCGAGGTAATAAGGCCACTGGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018789.2-1945s21c1
Sequence:CCGGACTCAAGTGTTGAGGAAATTACTCGAGTAATTTCCTCAACACTTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018789.2-1062s21c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018789
FOXO4 MISSION shRNA Lentiviral Transduction Particles
forkhead box O4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1785s1c1
Sequence:CCGGGACTTCAACTTTGAGCCAGATCTCGAGATCTGGCTCAAAGTTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-779s1c1
Sequence:CCGGCAAGTTCATCAAGGTTCACAACTCGAGTTGTGAACCTTGATGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1701s1c1
Sequence:CCGGGATCTGGATCTTGATATGTATCTCGAGATACATATCAAGATCCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-330s1c1
Sequence:CCGGGCCGCGATCCTAGACCTCGATCTCGAGATCGAGGTCTAGGATCGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018789.1-1334s1c1
Sequence:CCGGTGGCCCAATAGATGGGTCTTTCTCGAGAAAGACCCATCTATTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018789.2-2150s21c1
Sequence:CCGGAGTCACCAGTGGCCTTATTACCTCGAGGTAATAAGGCCACTGGTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018789.2-1945s21c1
Sequence:CCGGACTCAAGTGTTGAGGAAATTACTCGAGTAATTTCCTCAACACTTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018789.2-1062s21c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005938
VALIDATED
FOXO4 MISSION shRNA Bacterial Glycerol Stock
forkhead box O4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005938.x-950s1c1
Sequence:CCGGCAGTTCAAATGCCAGCAGTGTCTCGAGACACTGCTGGCATTTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005938.x-1975s1c1
Sequence:CCGGCACTTAGGCTTTGTAGCAAGACTCGAGTCTTGCTACAAAGCCTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005938.1-1026s1c1
Sequence:CCGGCCAGCTTCAGTCAGCAGTTATCTCGAGATAACTGCTGACTGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005938.1-939s1c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-2537s21c1
Sequence:CCGGTGATAGTGACATGATACAAACCTCGAGGTTTGTATCATGTCACTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1754s21c1
Sequence:CCGGTCAGGATCTAGATCTTGATATCTCGAGATATCAAGATCTAGATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1267s21c1
Sequence:CCGGAGCTGTTAGATGGGCTCAATCCTCGAGGATTGAGCCCATCTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1122s21c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1090s21c1
Sequence:CCGGACCGTGAAGAAGCCGATATGTCTCGAGACATATCGGCTTCTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005938
VALIDATED
FOXO4 MISSION shRNA shRNA Plasmid DNA
forkhead box O4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005938.x-950s1c1
Sequence:CCGGCAGTTCAAATGCCAGCAGTGTCTCGAGACACTGCTGGCATTTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005938.x-1975s1c1
Sequence:CCGGCACTTAGGCTTTGTAGCAAGACTCGAGTCTTGCTACAAAGCCTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005938.1-1026s1c1
Sequence:CCGGCCAGCTTCAGTCAGCAGTTATCTCGAGATAACTGCTGACTGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005938.1-939s1c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-2537s21c1
Sequence:CCGGTGATAGTGACATGATACAAACCTCGAGGTTTGTATCATGTCACTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1754s21c1
Sequence:CCGGTCAGGATCTAGATCTTGATATCTCGAGATATCAAGATCTAGATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1267s21c1
Sequence:CCGGAGCTGTTAGATGGGCTCAATCCTCGAGGATTGAGCCCATCTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1122s21c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1090s21c1
Sequence:CCGGACCGTGAAGAAGCCGATATGTCTCGAGACATATCGGCTTCTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005938
VALIDATED
FOXO4 MISSION shRNA Lentiviral Transduction Particles
forkhead box O4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005938.x-950s1c1
Sequence:CCGGCAGTTCAAATGCCAGCAGTGTCTCGAGACACTGCTGGCATTTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005938.x-1975s1c1
Sequence:CCGGCACTTAGGCTTTGTAGCAAGACTCGAGTCTTGCTACAAAGCCTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005938.1-1026s1c1
Sequence:CCGGCCAGCTTCAGTCAGCAGTTATCTCGAGATAACTGCTGACTGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005938.1-939s1c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-2537s21c1
Sequence:CCGGTGATAGTGACATGATACAAACCTCGAGGTTTGTATCATGTCACTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1754s21c1
Sequence:CCGGTCAGGATCTAGATCTTGATATCTCGAGATATCAAGATCTAGATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1267s21c1
Sequence:CCGGAGCTGTTAGATGGGCTCAATCCTCGAGGATTGAGCCCATCTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1122s21c1
Sequence:CCGGCGTCCACGAAGCAGTTCAAATCTCGAGATTTGAACTGCTTCGTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005938.2-1090s21c1
Sequence:CCGGACCGTGAAGAAGCCGATATGTCTCGAGACATATCGGCTTCTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)