EMAIL THIS PAGE TO A FRIEND

FOXO6

forkhead box O6

37 Gene Product Result for
UniProtKB ID: A8MYZ6
Gene ID:
Mouse(329934) forkhead box O6
Rat(313558) forkhead box O6
sheep(101123434) forkhead box O6
naked mole-rat(101718574) forkhead box O6
domestic cat(101092130) forkhead box O6
cow(100847906) forkhead box O6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055911 MISSION® esiRNA esiRNA targeting mouse Foxo6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001053458 Rosetta Predictions rat pricing
XM_001057233 Rosetta Predictions rat pricing
NM_194060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272400 predicted 2247
2 SASI_Rn02_00272401 predicted 411
3 SASI_Rn02_00272402 predicted 2173
4 SASI_Rn02_00272403 predicted 313
5 SASI_Rn02_00272404 predicted 2127
6 SASI_Rn02_00272405 predicted 758
7 SASI_Rn02_00272406 predicted 2065
8 SASI_Rn02_00272407 predicted 447
9 SASI_Rn02_00272408 predicted 1967
10 SASI_Rn02_00272409 predicted 2244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285785 predicted 415
2 SASI_Rn02_00285786 predicted 318
3 SASI_Rn02_00285787 predicted 1636
4 SASI_Rn02_00285788 predicted 756
5 SASI_Rn02_00285789 predicted 1627
6 SASI_Rn02_00285790 predicted 448
7 SASI_Rn02_00285791 predicted 1664
8 SASI_Rn02_00285792 predicted 366
9 SASI_Rn02_00285793 predicted 512
10 SASI_Rn02_00285794 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153688 predicted 481
2 SASI_Mm01_00153690 predicted 2128
3 SASI_Mm01_00153691 predicted 327
4 SASI_Mm01_00153692 predicted 2149
5 SASI_Mm01_00153693 predicted 566
6 SASI_Mm01_00153694 predicted 1511
7 SASI_Mm01_00153695 predicted 2069
8 SASI_Mm02_00350582 predicted 366
9 SASI_Mm01_00153696 predicted 1564
10 SASI_Mm01_00153697 predicted 2071
11 SASI_Mm01_00153689 predicted 1588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194060
FOXO6 MISSION shRNA Bacterial Glycerol Stock
forkhead box O6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194060.1-2150s1c1
Sequence:CCGGCACCAATCTTAGTCATCCATTCTCGAGAATGGATGACTAAGATTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1593s1c1
Sequence:CCGGTGACGAAATGGACTTCAACTTCTCGAGAAGTTGAAGTCCATTTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1557s1c1
Sequence:CCGGCGTCGAGTCCATCATCCTCAACTCGAGTTGAGGATGATGGACTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-830s1c1
Sequence:CCGGCCTCGCCACTCATGTACCCAACTCGAGTTGGGTACATGAGTGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1590s1c1
Sequence:CCGGCAGTGACGAAATGGACTTCAACTCGAGTTGAAGTCCATTTCGTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194060
FOXO6 MISSION shRNA shRNA Plasmid DNA
forkhead box O6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194060.1-2150s1c1
Sequence:CCGGCACCAATCTTAGTCATCCATTCTCGAGAATGGATGACTAAGATTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1593s1c1
Sequence:CCGGTGACGAAATGGACTTCAACTTCTCGAGAAGTTGAAGTCCATTTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1557s1c1
Sequence:CCGGCGTCGAGTCCATCATCCTCAACTCGAGTTGAGGATGATGGACTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-830s1c1
Sequence:CCGGCCTCGCCACTCATGTACCCAACTCGAGTTGGGTACATGAGTGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1590s1c1
Sequence:CCGGCAGTGACGAAATGGACTTCAACTCGAGTTGAAGTCCATTTCGTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194060
FOXO6 MISSION shRNA Lentiviral Transduction Particles
forkhead box O6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194060.1-2150s1c1
Sequence:CCGGCACCAATCTTAGTCATCCATTCTCGAGAATGGATGACTAAGATTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1593s1c1
Sequence:CCGGTGACGAAATGGACTTCAACTTCTCGAGAAGTTGAAGTCCATTTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1557s1c1
Sequence:CCGGCGTCGAGTCCATCATCCTCAACTCGAGTTGAGGATGATGGACTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-830s1c1
Sequence:CCGGCCTCGCCACTCATGTACCCAACTCGAGTTGGGTACATGAGTGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194060.1-1590s1c1
Sequence:CCGGCAGTGACGAAATGGACTTCAACTCGAGTTGAAGTCCATTTCGTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)