EMAIL THIS PAGE TO A FRIEND

FOXP1

forkhead box P1

321 Gene Product Result for
Synonyms: 12CC4 QRF1 hFKH1B
Gene ID:
Human(27086) Summary: This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Forkhead box P1 protein contains both DNA-binding- and protein-protein binding-domains. This gene may act as a tumor suppressor as it is lost in several tumor types and maps to a chromosomal region (3p14.1) reported to contain a tumor suppressor gene(s). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(108655) forkhead box P1
Rat(297480) forkhead box P1
chicken(416092) forkhead box P1
cow(515903) forkhead box P1
Horse(100053199) forkhead box P1
domestic cat(101092171) forkhead box P1
dog(484692) forkhead box P1
naked mole-rat(101722100) forkhead box P1
sheep(101114648) forkhead box P1
Domestic Rabbit(100345241) forkhead box P1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032682 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095671 MISSION® esiRNA esiRNA human FOXP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012505 Rosetta Predictions human pricing
NM_032682 Rosetta Predictions human pricing
NM_001034131 Rosetta Predictions rat pricing
NM_053202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228672 predicted 582
2 SASI_Hs01_00228673 predicted 809
3 SASI_Hs01_00228674 predicted 742
4 SASI_Hs01_00228675 predicted 553
5 SASI_Hs01_00228677 predicted 726
6 SASI_Hs01_00228679 predicted 741
7 SASI_Hs01_00228680 predicted 530
8 SASI_Hs02_00306167 predicted 807
9 SASI_Hs01_00228681 predicted 719
10 SASI_Hs02_00306168 predicted 553
11 SASI_Hs01_00228676 predicted 750
12 SASI_Hs01_00228678 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196090 predicted 1455
2 SASI_Hs01_00196091 predicted 1728
3 SASI_Hs01_00196092 predicted 1977
4 SASI_Hs02_00360221 predicted 2534
5 SASI_Hs01_00196093 predicted 1869
6 SASI_Hs01_00196095 predicted 2065
7 SASI_Hs01_00196096 predicted 1975
8 SASI_Hs01_00196097 predicted 2134
9 SASI_Hs01_00196098 predicted 1310
10 SASI_Hs01_00196099 predicted 2306
11 SASI_Hs01_00196094 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044538 predicted 1317
2 SASI_Rn01_00044539 predicted 1764
3 SASI_Rn01_00044541 predicted 1499
4 SASI_Rn02_00203977 predicted 1846
5 SASI_Rn01_00044542 predicted 1571
6 SASI_Rn01_00044543 predicted 1664
7 SASI_Rn01_00044545 predicted 1122
8 SASI_Rn01_00044546 predicted 1577
9 SASI_Rn01_00044547 predicted 1591
10 SASI_Rn02_00203978 predicted 1415
11 SASI_Rn01_00044540 predicted 1655
12 SASI_Rn01_00044544 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141050 predicted 1807
2 SASI_Mm01_00141051 predicted 1730
3 SASI_Mm01_00141052 predicted 1469
4 SASI_Mm01_00141053 predicted 1529
5 SASI_Mm01_00141054 predicted 1278
6 SASI_Mm01_00141055 predicted 1625
7 SASI_Mm01_00141056 predicted 1624
8 SASI_Mm01_00141057 predicted 1083
9 SASI_Mm01_00141058 predicted 1535
10 SASI_Mm01_00141059 predicted 1550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053202
VALIDATED
FOXP1 MISSION shRNA Bacterial Glycerol Stock
forkhead box P1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1469s1c1
Sequence:CCGGCGGAAGTTAGACCACCATTTACTCGAGTAAATGGTGGTCTAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053202.1-340s1c1
Sequence:CCGGCCCAAGAGGAATGACAAGCAACTCGAGTTGCTTGTCATTCCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-400s1c1
Sequence:CCGGCCTCAGGTTATCACTCCTCAACTCGAGTTGAGGAGTGATAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1539s1c1
Sequence:CCGGGCTAACACTAAACGAAATCTACTCGAGTAGATTTCGTTTAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1289s1c1
Sequence:CCGGGCTTACCTCATACTCCAACAACTCGAGTTGTTGGAGTATGAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-1098s21c1
Sequence:CCGGAGCTCAATGTAGAGTACAAATCTCGAGATTTGTACTCTACATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-315s21c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-1734s21c1
Sequence:CCGGTGGTAACCCTTCCCTTATTAACTCGAGTTAATAAGGGAAGGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053202.1-1654s21c1
Sequence:CCGGGTGCGAGTAGAGAACGTTAAACTCGAGTTTAACGTTCTCTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-685s21c1
Sequence:CCGGCGCCAAGGCCTCCTAACAATTCTCGAGAATTGTTAGGAGGCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053202
VALIDATED
FOXP1 MISSION shRNA shRNA Plasmid DNA
forkhead box P1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1469s1c1
Sequence:CCGGCGGAAGTTAGACCACCATTTACTCGAGTAAATGGTGGTCTAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053202.1-340s1c1
Sequence:CCGGCCCAAGAGGAATGACAAGCAACTCGAGTTGCTTGTCATTCCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-400s1c1
Sequence:CCGGCCTCAGGTTATCACTCCTCAACTCGAGTTGAGGAGTGATAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1539s1c1
Sequence:CCGGGCTAACACTAAACGAAATCTACTCGAGTAGATTTCGTTTAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1289s1c1
Sequence:CCGGGCTTACCTCATACTCCAACAACTCGAGTTGTTGGAGTATGAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-1098s21c1
Sequence:CCGGAGCTCAATGTAGAGTACAAATCTCGAGATTTGTACTCTACATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-315s21c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-1734s21c1
Sequence:CCGGTGGTAACCCTTCCCTTATTAACTCGAGTTAATAAGGGAAGGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053202.1-1654s21c1
Sequence:CCGGGTGCGAGTAGAGAACGTTAAACTCGAGTTTAACGTTCTCTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-685s21c1
Sequence:CCGGCGCCAAGGCCTCCTAACAATTCTCGAGAATTGTTAGGAGGCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053202
VALIDATED
FOXP1 MISSION shRNA Lentiviral Transduction Particles
forkhead box P1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1469s1c1
Sequence:CCGGCGGAAGTTAGACCACCATTTACTCGAGTAAATGGTGGTCTAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053202.1-340s1c1
Sequence:CCGGCCCAAGAGGAATGACAAGCAACTCGAGTTGCTTGTCATTCCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-400s1c1
Sequence:CCGGCCTCAGGTTATCACTCCTCAACTCGAGTTGAGGAGTGATAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1539s1c1
Sequence:CCGGGCTAACACTAAACGAAATCTACTCGAGTAGATTTCGTTTAGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053202.1-1289s1c1
Sequence:CCGGGCTTACCTCATACTCCAACAACTCGAGTTGTTGGAGTATGAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-1098s21c1
Sequence:CCGGAGCTCAATGTAGAGTACAAATCTCGAGATTTGTACTCTACATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-315s21c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-1734s21c1
Sequence:CCGGTGGTAACCCTTCCCTTATTAACTCGAGTTAATAAGGGAAGGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053202.1-1654s21c1
Sequence:CCGGGTGCGAGTAGAGAACGTTAAACTCGAGTTTAACGTTCTCTACTCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053202.1-685s21c1
Sequence:CCGGCGCCAAGGCCTCCTAACAATTCTCGAGAATTGTTAGGAGGCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032682
VALIDATED
FOXP1 MISSION shRNA Bacterial Glycerol Stock
forkhead box P1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-1814s1c1
Sequence:CCGGCGCAGAAGTTAGACCACCATTCTCGAGAATGGTGGTCTAACTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032682.3-656s1c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-1766s1c1
Sequence:CCGGGCCCATTTCGTCAGCAGATATCTCGAGATATCTGCTGACGAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-2151s1c1
Sequence:CCGGCAGGCTTCAATGGCTGAGAATCTCGAGATTCTCAGCCATTGAAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032682.3-1379s1c1
Sequence:CCGGGTGCGAAGATTTCCAATCATTCTCGAGAATGATTGGAAATCTTCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-751s21c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-1540s21c1
Sequence:CCGGAGCCCAATGTAGAGTACAAATCTCGAGATTTGTACTCTACATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032682.4-4667s21c1
Sequence:CCGGTGCAATTAGAGTATCCAATAACTCGAGTTATTGGATACTCTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-2176s21c1
Sequence:CCGGTGGTAACCCTTCCCTTATTAACTCGAGTTAATAAGGGAAGGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032682.4-1475s21c1
Sequence:CCGGTGCGAAGATTTCCAATCATTTCTCGAGAAATGATTGGAAATCTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032682
VALIDATED
FOXP1 MISSION shRNA shRNA Plasmid DNA
forkhead box P1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-1814s1c1
Sequence:CCGGCGCAGAAGTTAGACCACCATTCTCGAGAATGGTGGTCTAACTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032682.3-656s1c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-1766s1c1
Sequence:CCGGGCCCATTTCGTCAGCAGATATCTCGAGATATCTGCTGACGAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-2151s1c1
Sequence:CCGGCAGGCTTCAATGGCTGAGAATCTCGAGATTCTCAGCCATTGAAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032682.3-1379s1c1
Sequence:CCGGGTGCGAAGATTTCCAATCATTCTCGAGAATGATTGGAAATCTTCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-751s21c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-1540s21c1
Sequence:CCGGAGCCCAATGTAGAGTACAAATCTCGAGATTTGTACTCTACATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032682.4-4667s21c1
Sequence:CCGGTGCAATTAGAGTATCCAATAACTCGAGTTATTGGATACTCTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-2176s21c1
Sequence:CCGGTGGTAACCCTTCCCTTATTAACTCGAGTTAATAAGGGAAGGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032682.4-1475s21c1
Sequence:CCGGTGCGAAGATTTCCAATCATTTCTCGAGAAATGATTGGAAATCTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032682
VALIDATED
FOXP1 MISSION shRNA Lentiviral Transduction Particles
forkhead box P1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-1814s1c1
Sequence:CCGGCGCAGAAGTTAGACCACCATTCTCGAGAATGGTGGTCTAACTTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032682.3-656s1c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-1766s1c1
Sequence:CCGGGCCCATTTCGTCAGCAGATATCTCGAGATATCTGCTGACGAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032682.3-2151s1c1
Sequence:CCGGCAGGCTTCAATGGCTGAGAATCTCGAGATTCTCAGCCATTGAAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032682.3-1379s1c1
Sequence:CCGGGTGCGAAGATTTCCAATCATTCTCGAGAATGATTGGAAATCTTCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-751s21c1
Sequence:CCGGGCAGCAAGTTAGTGGATTAAACTCGAGTTTAATCCACTAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-1540s21c1
Sequence:CCGGAGCCCAATGTAGAGTACAAATCTCGAGATTTGTACTCTACATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032682.4-4667s21c1
Sequence:CCGGTGCAATTAGAGTATCCAATAACTCGAGTTATTGGATACTCTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032682.4-2176s21c1
Sequence:CCGGTGGTAACCCTTCCCTTATTAACTCGAGTTAATAAGGGAAGGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032682.4-1475s21c1
Sequence:CCGGTGCGAAGATTTCCAATCATTTCTCGAGAAATGATTGGAAATCTTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks