EMAIL THIS PAGE TO A FRIEND

FOXP2

forkhead box P2

315 Gene Product Result for
Synonyms: CAGH44 SPCH1 TNRC10
Gene ID:
Human(93986) Summary: This gene encodes a member of the forkhead/winged-helix (FOX) family of transcription factors. It is expressed in fetal and adult brain as well as in several other organs such as the lung and gut. The protein product contains a FOX DNA-binding domain and a large polyglutamine tract and is an evolutionarily conserved transcription factor, which may bind directly to approximately 300 to 400 gene promoters in the human genome to regulate the expression of a variety of genes. This gene is required for proper development of speech and language regions of the brain during embryogenesis, and may be involved in a variety of biological pathways and cascades that may ultimately influence language development. Mutations in this gene cause speech-language disorder 1 (SPCH1), also known as autosomal dominant speech and language disorder with orofacial dyspraxia. Multiple alternative transcripts encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Mouse(114142) forkhead box P2
Rat(500037) forkhead box P2
Zebrafish(555242) forkhead box P2
chicken(769935) forkhead box P2
dog(482413) forkhead box P2
domestic cat(100134847) forkhead box P2
Goat(100860795) forkhead box P2
Domestic Rabbit(100328793) forkhead box P2
sheep(101110051) forkhead box P2
naked mole-rat(101699542) forkhead box P2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500421 Anti-FOXP2 (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat, canine
ELISA, immunohistochemistry, western blot pricing
F6304 Anti-FOXP2 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
microarray, western blot pricing
HPA000382 Anti-FOXP2 antibody produced in rabbit AB1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV33750 Anti-FOXP2 antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, canine, horse, rat, pig
western blot pricing
HPA000383 Anti-FOXP2 antibody produced in rabbit AB2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB4300688 Anti-FOXP2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
HPA001679 Anti-FOXP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2500420 Anti-FOXP2, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB5300294 Monoclonal Anti-FOXP2 antibody produced in mouse clone 5C11A8, ascites fluid human
ELISA, western blot pricing
SAB5300295 Monoclonal Anti-FOXP2 antibody produced in mouse clone 5C11A2, ascites fluid human
ELISA, western blot pricing
SAB1403430 Monoclonal Anti-FOXP2, (C-terminal) antibody produced in mouse clone 1F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014491 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014491 Rosetta Predictions human pricing
NM_148898 Rosetta Predictions human pricing
NM_148899 Rosetta Predictions human pricing
NM_148900 Rosetta Predictions human pricing
XM_001056575 Rosetta Predictions rat pricing
XM_575393 Rosetta Predictions rat pricing
NM_053242 Rosetta Predictions mouse pricing
NM_212435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345741 predicted 2475
2 SASI_Hs01_00020940 predicted 2245
3 SASI_Hs01_00020942 predicted 1955
4 SASI_Hs01_00020943 predicted 1996
5 SASI_Hs02_00345742 predicted 1635
6 SASI_Hs01_00020944 predicted 2437
7 SASI_Hs01_00020945 predicted 2319
8 SASI_Hs02_00345743 predicted 1468
9 SASI_Hs01_00020946 predicted 1200
10 SASI_Hs01_00020948 predicted 2182
11 SASI_Hs01_00020941 predicted 1709
12 SASI_Hs01_00020947 predicted 1652
13 SASI_Hs01_00020949 predicted 2230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365611 predicted 2550
2 SASI_Hs01_00041407 predicted 2313
3 SASI_Hs01_00041409 predicted 2024
4 SASI_Hs01_00041410 predicted 2069
5 SASI_Hs02_00365612 predicted 1708
6 SASI_Hs01_00041411 predicted 2516
7 SASI_Hs01_00041412 predicted 2392
8 SASI_Hs02_00365613 predicted 1542
9 SASI_Hs01_00041413 predicted 1275
10 SASI_Hs01_00041415 predicted 2252
11 SASI_Hs01_00041408 predicted 1778
12 SASI_Hs01_00041414 predicted 1733
13 SASI_Hs01_00041416 predicted 2301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365614 predicted 2535
2 SASI_Hs02_00365615 predicted 2223
3 SASI_Hs01_00023803 predicted 2304
4 SASI_Hs01_00023805 predicted 2012
5 SASI_Hs01_00023806 predicted 2056
6 SASI_Hs02_00365616 predicted 1691
7 SASI_Hs01_00023807 predicted 2492
8 SASI_Hs01_00023808 predicted 2381
9 SASI_Hs02_00365617 predicted 1522
10 SASI_Hs01_00023809 predicted 1257
11 SASI_Hs01_00023804 predicted 1767
12 SASI_Hs01_00023810 predicted 1714
13 SASI_Hs01_00023811 predicted 2026
14 SASI_Hs01_00023812 predicted 2283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070983 predicted 2159
2 SASI_Hs01_00070984 predicted 1849
3 SASI_Hs01_00070985 predicted 1875
4 SASI_Hs01_00070986 predicted 1909
5 SASI_Hs01_00070987 predicted 2351
6 SASI_Hs01_00070988 predicted 2237
7 SASI_Hs01_00070989 predicted 1119
8 SASI_Hs01_00070990 predicted 1786
9 SASI_Hs01_00070991 predicted 2091
10 SASI_Hs01_00070992 predicted 2363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283684 predicted 2494
2 SASI_Rn02_00283685 predicted 1452
3 SASI_Rn02_00283686 predicted 383
4 SASI_Rn02_00283687 predicted 339
5 SASI_Rn02_00283688 predicted 2413
6 SASI_Rn02_00283689 predicted 1303
7 SASI_Rn02_00283690 predicted 1477
8 SASI_Rn02_00283691 predicted 1649
9 SASI_Rn02_00283692 predicted 1549
10 SASI_Rn02_00283693 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403621 predicted 1977
2 SASI_Rn02_00403622 predicted 459
3 SASI_Rn02_00403623 predicted 56
4 SASI_Rn02_00403624 predicted 399
5 SASI_Rn02_00403625 predicted 780
6 SASI_Rn02_00403626 predicted 969
7 SASI_Rn02_00403627 predicted 1131
8 SASI_Rn02_00403628 predicted 1041
9 SASI_Rn02_00403629 predicted 1115
10 SASI_Rn02_00403630 predicted 1692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337840 predicted 2220
2 SASI_Mm01_00022526 predicted 2212
3 SASI_Mm01_00022527 predicted 2154
4 SASI_Mm01_00022528 predicted 1816
5 SASI_Mm01_00022529 predicted 1917
6 SASI_Mm01_00022530 predicted 2706
7 SASI_Mm01_00022531 predicted 868
8 SASI_Mm01_00022532 predicted 1903
9 SASI_Mm01_00022533 predicted 2668
10 SASI_Mm01_00022534 predicted 1829
11 SASI_Mm01_00022535 predicted 1870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169695 predicted 2428
2 SASI_Mm02_00352254 predicted 1885
3 SASI_Mm01_00169696 predicted 1866
4 SASI_Mm01_00169697 predicted 1820
5 SASI_Mm01_00169698 predicted 1480
6 SASI_Mm01_00169699 predicted 1580
7 SASI_Mm01_00169700 predicted 2368
8 SASI_Mm01_00169701 predicted 2424
9 SASI_Mm01_00169702 predicted 531
10 SASI_Mm01_00169703 predicted 1563
11 SASI_Mm01_00169704 predicted 2344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014491
FOXP2 MISSION shRNA Bacterial Glycerol Stock
forkhead box P2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-1240s21c1
Sequence:CCGGTAGACCTCACTACTAACAATTCTCGAGAATTGTTAGTAGTGAGGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-1626s21c1
Sequence:CCGGCCATCTCCCAAACCTCTAAATCTCGAGATTTAGAGGTTTGGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-2311s21c1
Sequence:CCGGATGGTTCTCTGGATCACATTGCTCGAGCAATGTGATCCAGAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-239s1c1
Sequence:CCGGGCAGCAGAGATGGAAGATCAACTCGAGTTGATCTTCCATCTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-2019s1c1
Sequence:CCGGGCTAAGTAATCCTGGACTGATCTCGAGATCAGTCCAGGATTACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-1248s1c1
Sequence:CCGGCCTTAACAATGAACACGCATTCTCGAGAATGCGTGTTCATTGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-351s1c1
Sequence:CCGGGCAGCAAACAAGTGGATTGAACTCGAGTTCAATCCACTTGTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-1786s1c1
Sequence:CCGGGCAACTTGGAAGAATGCAGTACTCGAGTACTGCATTCTTCCAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014491
FOXP2 MISSION shRNA shRNA Plasmid DNA
forkhead box P2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-1240s21c1
Sequence:CCGGTAGACCTCACTACTAACAATTCTCGAGAATTGTTAGTAGTGAGGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-1626s21c1
Sequence:CCGGCCATCTCCCAAACCTCTAAATCTCGAGATTTAGAGGTTTGGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-2311s21c1
Sequence:CCGGATGGTTCTCTGGATCACATTGCTCGAGCAATGTGATCCAGAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-239s1c1
Sequence:CCGGGCAGCAGAGATGGAAGATCAACTCGAGTTGATCTTCCATCTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-2019s1c1
Sequence:CCGGGCTAAGTAATCCTGGACTGATCTCGAGATCAGTCCAGGATTACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-1248s1c1
Sequence:CCGGCCTTAACAATGAACACGCATTCTCGAGAATGCGTGTTCATTGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-351s1c1
Sequence:CCGGGCAGCAAACAAGTGGATTGAACTCGAGTTCAATCCACTTGTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-1786s1c1
Sequence:CCGGGCAACTTGGAAGAATGCAGTACTCGAGTACTGCATTCTTCCAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014491
FOXP2 MISSION shRNA Lentiviral Transduction Particles
forkhead box P2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-1240s21c1
Sequence:CCGGTAGACCTCACTACTAACAATTCTCGAGAATTGTTAGTAGTGAGGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-1626s21c1
Sequence:CCGGCCATCTCCCAAACCTCTAAATCTCGAGATTTAGAGGTTTGGGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014491.2-2311s21c1
Sequence:CCGGATGGTTCTCTGGATCACATTGCTCGAGCAATGTGATCCAGAGAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-239s1c1
Sequence:CCGGGCAGCAGAGATGGAAGATCAACTCGAGTTGATCTTCCATCTCTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-2019s1c1
Sequence:CCGGGCTAAGTAATCCTGGACTGATCTCGAGATCAGTCCAGGATTACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-1248s1c1
Sequence:CCGGCCTTAACAATGAACACGCATTCTCGAGAATGCGTGTTCATTGTTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-351s1c1
Sequence:CCGGGCAGCAAACAAGTGGATTGAACTCGAGTTCAATCCACTTGTTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014491.1-1786s1c1
Sequence:CCGGGCAACTTGGAAGAATGCAGTACTCGAGTACTGCATTCTTCCAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053242
FOXP2 MISSION shRNA Bacterial Glycerol Stock
forkhead box P2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-2046s1c1
Sequence:CCGGGCGACATTCAGACAAATACAACTCGAGTTGTATTTGTCTGAATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-1569s1c1
Sequence:CCGGCGGACAGTCTTCAGTTCTGAACTCGAGTTCAGAACTGAAGACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053242.3-5001s1c1
Sequence:CCGGCGGAAGTTATTGATGTGGTATCTCGAGATACCACATCAATAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-2611s1c1
Sequence:CCGGCCACACATACATTCAATCCATCTCGAGATGGATTGAATGTATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-650s1c1
Sequence:CCGGGCAACAGTTCAATGAATCAAACTCGAGTTTGATTCATTGAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053242
FOXP2 MISSION shRNA shRNA Plasmid DNA
forkhead box P2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-2046s1c1
Sequence:CCGGGCGACATTCAGACAAATACAACTCGAGTTGTATTTGTCTGAATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-1569s1c1
Sequence:CCGGCGGACAGTCTTCAGTTCTGAACTCGAGTTCAGAACTGAAGACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053242.3-5001s1c1
Sequence:CCGGCGGAAGTTATTGATGTGGTATCTCGAGATACCACATCAATAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-2611s1c1
Sequence:CCGGCCACACATACATTCAATCCATCTCGAGATGGATTGAATGTATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-650s1c1
Sequence:CCGGGCAACAGTTCAATGAATCAAACTCGAGTTTGATTCATTGAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053242
FOXP2 MISSION shRNA Lentiviral Transduction Particles
forkhead box P2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-2046s1c1
Sequence:CCGGGCGACATTCAGACAAATACAACTCGAGTTGTATTTGTCTGAATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-1569s1c1
Sequence:CCGGCGGACAGTCTTCAGTTCTGAACTCGAGTTCAGAACTGAAGACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053242.3-5001s1c1
Sequence:CCGGCGGAAGTTATTGATGTGGTATCTCGAGATACCACATCAATAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-2611s1c1
Sequence:CCGGCCACACATACATTCAATCCATCTCGAGATGGATTGAATGTATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053242.3-650s1c1
Sequence:CCGGGCAACAGTTCAATGAATCAAACTCGAGTTTGATTCATTGAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks