EMAIL THIS PAGE TO A FRIEND

FOXP3

forkhead box P3

70 Gene Product Result for
Synonyms: AIID DIETER IPEX PIDX XPID
UniProtKB ID: Q9BZS1, A5HJT1, B7ZLG0, O60827, Q14DD8, Q4ZH51
Gene ID:
Human(50943) Summary: The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene are the cause of immunodeficiency polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(20371) forkhead box P3
Rat(317382) forkhead box P3
naked mole-rat(101722447) forkhead box P3
sheep(100240742) forkhead box P3
domestic cat(100037405) forkhead box P3
cow(506053) forkhead box P3
Horse(100052226) forkhead box P3
dog(491876) forkhead box P3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108477 Anti-FOXP3 IgG fraction of antiserum rabbit, pig, guinea pig, rat, human, mouse, sheep, canine, horse, bovine
immunohistochemistry, western blot pricing
SAB2700362 Anti-Foxp3 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB1407427 Anti-FOXP3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV32743 Anti-FOXP3 antibody produced in rabbit IgG fraction of antiserum pig, human, mouse, canine, sheep, rabbit, bovine, horse, rat, guinea pig
immunohistochemistry, western blot pricing
SAB1410887 Anti-FOXP3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA045943 Anti-FOXP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB5500109 Anti-FOXP3 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP97, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB2500422 Anti-FOXP3/Scurfin antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB4700610 Monoclonal Anti-FOXP3 antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry pricing
SAB5300461 Monoclonal Anti-FOXP3 antibody produced in mouse clone 2A11G9, ascites fluid mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300462 Monoclonal Anti-FOXP3 antibody produced in mouse clone 4C7, ascites fluid human
ELISA, western blot pricing
SAB4700611 Monoclonal Anti-FOXP3-PE antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114377 Rosetta Predictions human pricing
NM_014009 Rosetta Predictions human pricing
NM_001108250 Rosetta Predictions rat pricing
NM_054039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326534 predicted 674
2 SASI_Hs02_00326535 predicted 1230
3 SASI_Hs02_00326536 predicted 1151
4 SASI_Hs02_00326537 predicted 1239
5 SASI_Hs02_00326538 predicted 1184
6 SASI_Hs02_00326539 predicted 1046
7 SASI_Hs02_00326540 predicted 684
8 SASI_Hs02_00326541 predicted 784
9 SASI_Hs02_00326542 predicted 649
10 SASI_Hs02_00326543 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183632 predicted 777
2 SASI_Hs01_00183633 predicted 1343
3 SASI_Hs01_00183634 predicted 1254
4 SASI_Hs01_00183635 predicted 1349
5 SASI_Hs01_00183636 predicted 1292
6 SASI_Hs01_00183637 predicted 1151
7 SASI_Hs01_00183638 predicted 798
8 SASI_Hs01_00183640 predicted 885
9 SASI_Hs01_00183641 predicted 752
10 SASI_Hs02_00344980 predicted 1449
11 SASI_Hs01_00183639 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236804 predicted 1370
2 SASI_Rn02_00236805 predicted 1184
3 SASI_Rn02_00236806 predicted 1217
4 SASI_Rn02_00236807 predicted 1311
5 SASI_Rn02_00236808 predicted 770
6 SASI_Rn02_00236809 predicted 1634
7 SASI_Rn02_00236810 predicted 1835
8 SASI_Rn02_00236811 predicted 1871
9 SASI_Rn02_00236812 predicted 891
10 SASI_Rn02_00236813 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189752 predicted 1392
2 SASI_Mm01_00189753 predicted 1773
3 SASI_Mm01_00189754 predicted 1325
4 SASI_Mm01_00189756 predicted 1203
5 SASI_Mm02_00337944 predicted 1326
6 SASI_Mm01_00189757 predicted 1799
7 SASI_Mm01_00189758 predicted 704
8 SASI_Mm01_00189759 predicted 1332
9 SASI_Mm01_00189760 predicted 959
10 SASI_Mm01_00189761 predicted 545
11 SASI_Mm01_00189755 predicted 1851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054039
FOXP3 MISSION shRNA Bacterial Glycerol Stock
forkhead box P3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-420s1c1
Sequence:CCGGCCACACCTCTTCTTCCTTGAACTCGAGTTCAAGGAAGAAGAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1476s1c1
Sequence:CCGGGACCGTAGATGAATTTGAGTTCTCGAGAACTCAAATTCATCTACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1274s1c1
Sequence:CCGGCTTTCACCTATGCCACCCTTACTCGAGTAAGGGTGGCATAGGTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1209s1c1
Sequence:CCGGCAATAGTTCCTTCCCAGAGTTCTCGAGAACTCTGGGAAGGAACTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054039.1-1851s21c1
Sequence:CCGGACAGACACCATCCTAATATTTCTCGAGAAATATTAGGATGGTGTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054039.1-1359s21c1
Sequence:CCGGTACTCGCATGTTCGCCTACTTCTCGAGAAGTAGGCGAACATGCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054039.1-1897s21c1
Sequence:CCGGAGAGCCTGCCTTGGTACATTCCTCGAGGAATGTACCAAGGCAGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054039
FOXP3 MISSION shRNA shRNA Plasmid DNA
forkhead box P3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-420s1c1
Sequence:CCGGCCACACCTCTTCTTCCTTGAACTCGAGTTCAAGGAAGAAGAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1476s1c1
Sequence:CCGGGACCGTAGATGAATTTGAGTTCTCGAGAACTCAAATTCATCTACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1274s1c1
Sequence:CCGGCTTTCACCTATGCCACCCTTACTCGAGTAAGGGTGGCATAGGTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1209s1c1
Sequence:CCGGCAATAGTTCCTTCCCAGAGTTCTCGAGAACTCTGGGAAGGAACTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054039.1-1851s21c1
Sequence:CCGGACAGACACCATCCTAATATTTCTCGAGAAATATTAGGATGGTGTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054039.1-1359s21c1
Sequence:CCGGTACTCGCATGTTCGCCTACTTCTCGAGAAGTAGGCGAACATGCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054039.1-1897s21c1
Sequence:CCGGAGAGCCTGCCTTGGTACATTCCTCGAGGAATGTACCAAGGCAGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054039
FOXP3 MISSION shRNA Lentiviral Transduction Particles
forkhead box P3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-420s1c1
Sequence:CCGGCCACACCTCTTCTTCCTTGAACTCGAGTTCAAGGAAGAAGAGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1476s1c1
Sequence:CCGGGACCGTAGATGAATTTGAGTTCTCGAGAACTCAAATTCATCTACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1274s1c1
Sequence:CCGGCTTTCACCTATGCCACCCTTACTCGAGTAAGGGTGGCATAGGTGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054039.1-1209s1c1
Sequence:CCGGCAATAGTTCCTTCCCAGAGTTCTCGAGAACTCTGGGAAGGAACTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054039.1-1851s21c1
Sequence:CCGGACAGACACCATCCTAATATTTCTCGAGAAATATTAGGATGGTGTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054039.1-1359s21c1
Sequence:CCGGTACTCGCATGTTCGCCTACTTCTCGAGAAGTAGGCGAACATGCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054039.1-1897s21c1
Sequence:CCGGAGAGCCTGCCTTGGTACATTCCTCGAGGAATGTACCAAGGCAGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014009
FOXP3 MISSION shRNA Bacterial Glycerol Stock
forkhead box P3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1160s1c1
Sequence:CCGGCCTCCACAACATGGACTACTTCTCGAGAAGTAGTCCATGTTGTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-791s1c1
Sequence:CCGGGCCCGGATGTGAGAAGGTCTTCTCGAGAAGACCTTCTCACATCCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1289s1c1
Sequence:CCGGCACACGCATGTTTGCCTTCTTCTCGAGAAGAAGGCAAACATGCGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1353s1c1
Sequence:CCGGCTGAGTCTGCACAAGTGCTTTCTCGAGAAAGCACTTGTGCAGACTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-767s1c1
Sequence:CCGGGCTGGCAAATGGTGTCTGCAACTCGAGTTGCAGACACCATTTGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-1162s21c1
Sequence:CCGGTCCACAACATGGACTACTTCACTCGAGTGAAGTAGTCCATGTTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-756s21c1
Sequence:CCGGTCCTACCCACTGCTGGCAAATCTCGAGATTTGCCAGCAGTGGGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014009.3-1860s21c1
Sequence:CCGGTGTCCCTCACTCAACACAAACCTCGAGGTTTGTGTTGAGTGAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-1417s21c1
Sequence:CCGGAGCTGGAGTTCCGCAAGAAACCTCGAGGTTTCTTGCGGAACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014009
FOXP3 MISSION shRNA shRNA Plasmid DNA
forkhead box P3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1160s1c1
Sequence:CCGGCCTCCACAACATGGACTACTTCTCGAGAAGTAGTCCATGTTGTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-791s1c1
Sequence:CCGGGCCCGGATGTGAGAAGGTCTTCTCGAGAAGACCTTCTCACATCCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1289s1c1
Sequence:CCGGCACACGCATGTTTGCCTTCTTCTCGAGAAGAAGGCAAACATGCGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1353s1c1
Sequence:CCGGCTGAGTCTGCACAAGTGCTTTCTCGAGAAAGCACTTGTGCAGACTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-767s1c1
Sequence:CCGGGCTGGCAAATGGTGTCTGCAACTCGAGTTGCAGACACCATTTGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-1162s21c1
Sequence:CCGGTCCACAACATGGACTACTTCACTCGAGTGAAGTAGTCCATGTTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-756s21c1
Sequence:CCGGTCCTACCCACTGCTGGCAAATCTCGAGATTTGCCAGCAGTGGGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014009.3-1860s21c1
Sequence:CCGGTGTCCCTCACTCAACACAAACCTCGAGGTTTGTGTTGAGTGAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-1417s21c1
Sequence:CCGGAGCTGGAGTTCCGCAAGAAACCTCGAGGTTTCTTGCGGAACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014009
FOXP3 MISSION shRNA Lentiviral Transduction Particles
forkhead box P3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1160s1c1
Sequence:CCGGCCTCCACAACATGGACTACTTCTCGAGAAGTAGTCCATGTTGTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-791s1c1
Sequence:CCGGGCCCGGATGTGAGAAGGTCTTCTCGAGAAGACCTTCTCACATCCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1289s1c1
Sequence:CCGGCACACGCATGTTTGCCTTCTTCTCGAGAAGAAGGCAAACATGCGTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-1353s1c1
Sequence:CCGGCTGAGTCTGCACAAGTGCTTTCTCGAGAAAGCACTTGTGCAGACTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014009.2-767s1c1
Sequence:CCGGGCTGGCAAATGGTGTCTGCAACTCGAGTTGCAGACACCATTTGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-1162s21c1
Sequence:CCGGTCCACAACATGGACTACTTCACTCGAGTGAAGTAGTCCATGTTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-756s21c1
Sequence:CCGGTCCTACCCACTGCTGGCAAATCTCGAGATTTGCCAGCAGTGGGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014009.3-1860s21c1
Sequence:CCGGTGTCCCTCACTCAACACAAACCTCGAGGTTTGTGTTGAGTGAGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014009.3-1417s21c1
Sequence:CCGGAGCTGGAGTTCCGCAAGAAACCTCGAGGTTTCTTGCGGAACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)