EMAIL THIS PAGE TO A FRIEND

FOXP4

forkhead box P4

174 Gene Product Result for
Synonyms: hFKHLA
UniProtKB ID: Q8IVH2, Q5W098, Q7Z7F8, Q8IW55, Q96E19
Gene ID:
Human(116113) Summary: This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Many members of the forkhead box gene family, including members of subfamily P, have roles in mammalian oncogenesis. This gene may play a role in the development of tumors of the kidney and larynx. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(74123) forkhead box P4
Rat(363185) forkhead box P4
Zebrafish(557245) forkhead box P4
domestic cat(101091110) forkhead box P4
dog(481793) forkhead box P4
cow(517805) forkhead box P4
Horse(100054333) forkhead box P4
sheep(101108524) forkhead box P4
Domestic Rabbit(100328712) forkhead box P4
naked mole-rat(101714613) forkhead box P4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138457 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012426 Rosetta Predictions human pricing
NM_001012427 Rosetta Predictions human pricing
NM_138457 Rosetta Predictions human pricing
NM_001108788 Rosetta Predictions rat pricing
XM_343526 Rosetta Predictions rat pricing
NM_001110824 Rosetta Predictions mouse pricing
NM_001110825 Rosetta Predictions mouse pricing
NM_028767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028086 predicted 1912
2 SASI_Hs01_00028087 predicted 2150
3 SASI_Hs01_00028088 predicted 2701
4 SASI_Hs01_00028089 predicted 1955
5 SASI_Hs01_00028090 predicted 1900
6 SASI_Hs02_00306144 predicted 2023
7 SASI_Hs01_00028091 predicted 2060
8 SASI_Hs01_00028092 predicted 1969
9 SASI_Hs01_00028094 predicted 2477
10 SASI_Hs01_00028095 predicted 1999
11 SASI_Hs01_00028093 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026177 predicted 1901
2 SASI_Hs01_00026178 predicted 2135
3 SASI_Hs01_00026179 predicted 2698
4 SASI_Hs01_00026180 predicted 1950
5 SASI_Hs01_00026181 predicted 1901
6 SASI_Hs02_00306145 predicted 2013
7 SASI_Hs01_00026182 predicted 2057
8 SASI_Hs01_00026183 predicted 1968
9 SASI_Hs01_00026185 predicted 2474
10 SASI_Hs01_00026186 predicted 2000
11 SASI_Hs01_00026184 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059386 predicted 1872
2 SASI_Hs01_00059387 predicted 2104
3 SASI_Hs01_00059388 predicted 2659
4 SASI_Hs01_00059389 predicted 1917
5 SASI_Hs01_00059390 predicted 1867
6 SASI_Hs02_00363630 predicted 1980
7 SASI_Hs01_00059391 predicted 2025
8 SASI_Hs01_00059392 predicted 1932
9 SASI_Hs01_00059394 predicted 2441
10 SASI_Hs01_00059395 predicted 1967
11 SASI_Hs01_00059393 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242075 predicted 2284
2 SASI_Rn02_00242076 predicted 2069
3 SASI_Rn02_00242077 predicted 1614
4 SASI_Rn02_00242078 predicted 1546
5 SASI_Rn02_00242079 predicted 1475
6 SASI_Rn02_00242080 predicted 1466
7 SASI_Rn02_00242081 predicted 1146
8 SASI_Rn02_00242082 predicted 2261
9 SASI_Rn02_00242083 predicted 2117
10 SASI_Rn02_00242084 predicted 2058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00134148 predicted 1440
2 SASI_Rn01_00134149 predicted 2707
3 SASI_Rn01_00134150 predicted 885
4 SASI_Rn01_00134151 predicted 1996
5 SASI_Rn01_00134152 predicted 1917
6 SASI_Rn01_00134153 predicted 1606
7 SASI_Rn01_00134154 predicted 1575
8 SASI_Rn01_00134155 predicted 1360
9 SASI_Rn01_00134156 predicted 839
10 SASI_Rn01_00134157 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305798 predicted 1864
2 SASI_Mm02_00305799 predicted 1921
3 SASI_Mm02_00305800 predicted 2170
4 SASI_Mm02_00305801 predicted 1348
5 SASI_Mm02_00305802 predicted 2699
6 SASI_Mm02_00305803 predicted 1988
7 SASI_Mm02_00305804 predicted 1377
8 SASI_Mm02_00305805 predicted 444
9 SASI_Mm02_00305806 predicted 1874
10 SASI_Mm02_00305807 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305808 predicted 1821
2 SASI_Mm02_00305809 predicted 1881
3 SASI_Mm02_00305810 predicted 2136
4 SASI_Mm02_00305811 predicted 1355
5 SASI_Mm02_00305812 predicted 2663
6 SASI_Mm02_00305813 predicted 1953
7 SASI_Mm02_00305814 predicted 1382
8 SASI_Mm02_00305815 predicted 453
9 SASI_Mm02_00305816 predicted 1835
10 SASI_Mm02_00305817 predicted 2186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334362 predicted 1820
2 SASI_Mm01_00033499 predicted 1881
3 SASI_Mm02_00334363 predicted 2138
4 SASI_Mm01_00033500 predicted 1345
5 SASI_Mm02_00334364 predicted 2658
6 SASI_Mm01_00033501 predicted 1951
7 SASI_Mm01_00033502 predicted 1380
8 SASI_Mm02_00334365 predicted 447
9 SASI_Mm02_00334366 predicted 1840
10 SASI_Mm02_00334367 predicted 2187
11 SASI_Mm01_00033497 predicted 1235
12 SASI_Mm01_00033498 predicted 445
13 SASI_Mm01_00033503 predicted 1421
14 SASI_Mm01_00033504 predicted 1213
15 SASI_Mm01_00033505 predicted 2627
16 SASI_Mm01_00033506 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138457
FOXP4 MISSION shRNA Bacterial Glycerol Stock
forkhead box P4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1882s21c1
Sequence:CCGGTGACCCTGAATGAGATCTATACTCGAGTATAGATCTCATTCAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1611s21c1
Sequence:CCGGGTCTCTGCAGCAGACTCATTCCTCGAGGAATGAGTCTGCTGCAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1910s21c1
Sequence:CCGGCACCAGGATGTTCGCCTATTTCTCGAGAAATAGGCGAACATCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1784s21c1
Sequence:CCGGCCAGAATCATGAGTTCTACAACTCGAGTTGTAGAACTCATGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1421s21c1
Sequence:CCGGCCAGTTTATCAAACACCTCAACTCGAGTTGAGGTGTTTGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-717s1c1
Sequence:CCGGCCAGGGAACAATGACAGCAAACTCGAGTTTGCTGTCATTGTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1919s1c1
Sequence:CCGGGTTCGCCTATTTCCGCAGAAACTCGAGTTTCTGCGGAAATAGGCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1910s1c1
Sequence:CCGGCACCAGGATGTTCGCCTATTTCTCGAGAAATAGGCGAACATCCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1784s1c1
Sequence:CCGGCCAGAATCATGAGTTCTACAACTCGAGTTGTAGAACTCATGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138457
FOXP4 MISSION shRNA shRNA Plasmid DNA
forkhead box P4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1882s21c1
Sequence:CCGGTGACCCTGAATGAGATCTATACTCGAGTATAGATCTCATTCAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1611s21c1
Sequence:CCGGGTCTCTGCAGCAGACTCATTCCTCGAGGAATGAGTCTGCTGCAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1910s21c1
Sequence:CCGGCACCAGGATGTTCGCCTATTTCTCGAGAAATAGGCGAACATCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1784s21c1
Sequence:CCGGCCAGAATCATGAGTTCTACAACTCGAGTTGTAGAACTCATGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1421s21c1
Sequence:CCGGCCAGTTTATCAAACACCTCAACTCGAGTTGAGGTGTTTGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-717s1c1
Sequence:CCGGCCAGGGAACAATGACAGCAAACTCGAGTTTGCTGTCATTGTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1919s1c1
Sequence:CCGGGTTCGCCTATTTCCGCAGAAACTCGAGTTTCTGCGGAAATAGGCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1910s1c1
Sequence:CCGGCACCAGGATGTTCGCCTATTTCTCGAGAAATAGGCGAACATCCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1784s1c1
Sequence:CCGGCCAGAATCATGAGTTCTACAACTCGAGTTGTAGAACTCATGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138457
FOXP4 MISSION shRNA Lentiviral Transduction Particles
forkhead box P4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1882s21c1
Sequence:CCGGTGACCCTGAATGAGATCTATACTCGAGTATAGATCTCATTCAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1611s21c1
Sequence:CCGGGTCTCTGCAGCAGACTCATTCCTCGAGGAATGAGTCTGCTGCAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1910s21c1
Sequence:CCGGCACCAGGATGTTCGCCTATTTCTCGAGAAATAGGCGAACATCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1784s21c1
Sequence:CCGGCCAGAATCATGAGTTCTACAACTCGAGTTGTAGAACTCATGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138457.2-1421s21c1
Sequence:CCGGCCAGTTTATCAAACACCTCAACTCGAGTTGAGGTGTTTGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-717s1c1
Sequence:CCGGCCAGGGAACAATGACAGCAAACTCGAGTTTGCTGTCATTGTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1919s1c1
Sequence:CCGGGTTCGCCTATTTCCGCAGAAACTCGAGTTTCTGCGGAAATAGGCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1910s1c1
Sequence:CCGGCACCAGGATGTTCGCCTATTTCTCGAGAAATAGGCGAACATCCTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138457.1-1784s1c1
Sequence:CCGGCCAGAATCATGAGTTCTACAACTCGAGTTGTAGAACTCATGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028767
FOXP4 MISSION shRNA Bacterial Glycerol Stock
forkhead box P4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-1692s1c1
Sequence:CCGGGCTGACGCTAAATGAGATTTACTCGAGTAAATCTCATTTAGCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-826s1c1
Sequence:CCGGCAGATGCAACAGTTGCAGCAACTCGAGTTGCTGCAACTGTTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-2570s1c1
Sequence:CCGGCAGAGCTGGAAACGATGAGATCTCGAGATCTCATCGTTTCCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-2309s1c1
Sequence:CCGGCCCTCCTTCACTTAAGTTATTCTCGAGAATAACTTAAGTGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-1545s1c1
Sequence:CCGGCCGCAGGAGAAGTAATGACAACTCGAGTTGTCATTACTTCTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028767
FOXP4 MISSION shRNA shRNA Plasmid DNA
forkhead box P4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-1692s1c1
Sequence:CCGGGCTGACGCTAAATGAGATTTACTCGAGTAAATCTCATTTAGCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-826s1c1
Sequence:CCGGCAGATGCAACAGTTGCAGCAACTCGAGTTGCTGCAACTGTTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-2570s1c1
Sequence:CCGGCAGAGCTGGAAACGATGAGATCTCGAGATCTCATCGTTTCCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-2309s1c1
Sequence:CCGGCCCTCCTTCACTTAAGTTATTCTCGAGAATAACTTAAGTGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-1545s1c1
Sequence:CCGGCCGCAGGAGAAGTAATGACAACTCGAGTTGTCATTACTTCTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028767
FOXP4 MISSION shRNA Lentiviral Transduction Particles
forkhead box P4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-1692s1c1
Sequence:CCGGGCTGACGCTAAATGAGATTTACTCGAGTAAATCTCATTTAGCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-826s1c1
Sequence:CCGGCAGATGCAACAGTTGCAGCAACTCGAGTTGCTGCAACTGTTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-2570s1c1
Sequence:CCGGCAGAGCTGGAAACGATGAGATCTCGAGATCTCATCGTTTCCAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-2309s1c1
Sequence:CCGGCCCTCCTTCACTTAAGTTATTCTCGAGAATAACTTAAGTGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028767.1-1545s1c1
Sequence:CCGGCCGCAGGAGAAGTAATGACAACTCGAGTTGTCATTACTTCTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks