EMAIL THIS PAGE TO A FRIEND

FOXQ1

forkhead box Q1

100 Gene Product Result for
Synonyms: HFH1
UniProtKB ID: Q9C009, Q9NS06
Gene ID:
Human(94234) Summary: FOXQ1 is a member of the FOX gene family, which is characterized by a conserved 110-amino acid DNA-binding motif called the forkhead or winged helix domain. FOX genes are involved in embryonic development, cell cycle regulation, tissue-specific gene expression, cell signaling, and tumorigenesis (Bieller et al., 2001 [PubMed 11747606]
Mouse(15220) forkhead box Q1
Rat(64826) forkhead box Q1
naked mole-rat(101704903) forkhead box Q1
domestic cat(101090186) forkhead box Q1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39754 Anti-FOXQ1 (AB1) antibody produced in rabbit IgG fraction of antiserum rat, mouse, human
western blot pricing
AV39755 Anti-FOXQ1 (AB2) antibody produced in rabbit IgG fraction of antiserum human
immunohistochemistry, western blot pricing
SAB1412184 ANTI-FOXQ1 antibody produced in mouse clone 1A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412185 ANTI-FOXQ1 antibody produced in mouse clone 3E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412186 ANTI-FOXQ1 antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412187 ANTI-FOXQ1 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412485 ANTI-FOXQ1 antibody produced in mouse clone 4E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412486 ANTI-FOXQ1 antibody produced in mouse clone 2F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412487 ANTI-FOXQ1 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412505 ANTI-FOXQ1 antibody produced in mouse clone 4H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107907 Anti-FOXQ1 antibody produced in rabbit affinity isolated antibody mouse, human, pig, rat
immunohistochemistry, western blot pricing
AV33747 Anti-FOXQ1 antibody produced in rabbit affinity isolated antibody, lyophilized powder human
immunohistochemistry, western blot pricing
SAB2105258 Anti-FOXQ1 antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
HPA059700 Anti-FOXQ1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2105257 Anti-FOXQ1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB2500424 Anti-FOXQ1/FKHRL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
WH0094234M1 Monoclonal Anti-FOXQ1 antibody produced in mouse clone 2H6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1405331 Monoclonal Anti-FOXQ1 antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033260 Rosetta Predictions human pricing
NM_022858 Rosetta Predictions rat pricing
NM_008239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133680 predicted 1763
2 SASI_Hs02_00361057 predicted 1761
3 SASI_Hs01_00133682 predicted 1592
4 SASI_Hs01_00133683 predicted 1596
5 SASI_Hs02_00361058 predicted 1764
6 SASI_Hs01_00133684 predicted 1597
7 SASI_Hs02_00361059 predicted 1582
8 SASI_Hs01_00133685 predicted 1584
9 SASI_Hs01_00133686 predicted 1764
10 SASI_Hs01_00133687 predicted 1621
11 SASI_Hs01_00133681 predicted 1730
12 SASI_Hs01_00133688 predicted 1625
13 SASI_Hs01_00133689 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079100 predicted 757
2 SASI_Rn01_00079101 predicted 612
3 SASI_Rn01_00079102 predicted 664
4 SASI_Rn02_00263589 predicted 436
5 SASI_Rn01_00079103 predicted 616
6 SASI_Rn01_00079105 predicted 1101
7 SASI_Rn01_00079106 predicted 1019
8 SASI_Rn01_00079107 predicted 993
9 SASI_Rn01_00079108 predicted 1065
10 SASI_Rn01_00079109 predicted 1258
11 SASI_Rn01_00079104 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073196 predicted 1832
2 SASI_Mm01_00073197 predicted 1793
3 SASI_Mm01_00073198 predicted 1833
4 SASI_Mm01_00073199 predicted 1736
5 SASI_Mm01_00073200 predicted 1701
6 SASI_Mm01_00073201 predicted 1810
7 SASI_Mm01_00073202 predicted 1800
8 SASI_Mm01_00073203 predicted 1726
9 SASI_Mm01_00073204 predicted 1726
10 SASI_Mm01_00073205 predicted 1715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008239
VALIDATED
FOXQ1 MISSION shRNA Bacterial Glycerol Stock
forkhead box Q1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008239.3-1821s1c1
Sequence:CCGGCTCTCCATCAAATGTGCCTTACTCGAGTAAGGCACATTTGATGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-580s1c1
Sequence:CCGGGCGGCTGGTGACGACTCCTTACTCGAGTAAGGAGTCGTCACCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-1436s1c1
Sequence:CCGGCGCTCTGTGCTTACGGCGCAACTCGAGTTGCGCCGTAAGCACAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-1287s1c1
Sequence:CCGGCATCGACAGCATTCTCAGCAACTCGAGTTGCTGAGAATGCTGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-897s1c1
Sequence:CCGGCGAGATCAACGAGTACCTCATCTCGAGATGAGGTACTCGTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1327s21c1
Sequence:CCGGCCCAACAGCGAATACACCTTCCTCGAGGAAGGTGTATTCGCTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008239.4-1305s21c1
Sequence:CCGGGGACAACTACTGGATGCTCAACTCGAGTTGAGCATCCAGTAGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1931s21c1
Sequence:CCGGTGGAGACTCTGCTAGCTTGACCTCGAGGTCAAGCTAGCAGAGTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008239.4-2088s21c1
Sequence:CCGGCTCTCCATCAAATGTGCCTTACTCGAGTAAGGCACATTTGATGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1164s21c1
Sequence:CCGGCGAGATCAACGAGTACCTCATCTCGAGATGAGGTACTCGTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008239
VALIDATED
FOXQ1 MISSION shRNA shRNA Plasmid DNA
forkhead box Q1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008239.3-1821s1c1
Sequence:CCGGCTCTCCATCAAATGTGCCTTACTCGAGTAAGGCACATTTGATGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-580s1c1
Sequence:CCGGGCGGCTGGTGACGACTCCTTACTCGAGTAAGGAGTCGTCACCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-1436s1c1
Sequence:CCGGCGCTCTGTGCTTACGGCGCAACTCGAGTTGCGCCGTAAGCACAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-1287s1c1
Sequence:CCGGCATCGACAGCATTCTCAGCAACTCGAGTTGCTGAGAATGCTGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-897s1c1
Sequence:CCGGCGAGATCAACGAGTACCTCATCTCGAGATGAGGTACTCGTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1327s21c1
Sequence:CCGGCCCAACAGCGAATACACCTTCCTCGAGGAAGGTGTATTCGCTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008239.4-1305s21c1
Sequence:CCGGGGACAACTACTGGATGCTCAACTCGAGTTGAGCATCCAGTAGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1931s21c1
Sequence:CCGGTGGAGACTCTGCTAGCTTGACCTCGAGGTCAAGCTAGCAGAGTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008239.4-2088s21c1
Sequence:CCGGCTCTCCATCAAATGTGCCTTACTCGAGTAAGGCACATTTGATGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1164s21c1
Sequence:CCGGCGAGATCAACGAGTACCTCATCTCGAGATGAGGTACTCGTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008239
VALIDATED
FOXQ1 MISSION shRNA Lentiviral Transduction Particles
forkhead box Q1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008239.3-1821s1c1
Sequence:CCGGCTCTCCATCAAATGTGCCTTACTCGAGTAAGGCACATTTGATGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-580s1c1
Sequence:CCGGGCGGCTGGTGACGACTCCTTACTCGAGTAAGGAGTCGTCACCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-1436s1c1
Sequence:CCGGCGCTCTGTGCTTACGGCGCAACTCGAGTTGCGCCGTAAGCACAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-1287s1c1
Sequence:CCGGCATCGACAGCATTCTCAGCAACTCGAGTTGCTGAGAATGCTGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008239.3-897s1c1
Sequence:CCGGCGAGATCAACGAGTACCTCATCTCGAGATGAGGTACTCGTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1327s21c1
Sequence:CCGGCCCAACAGCGAATACACCTTCCTCGAGGAAGGTGTATTCGCTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008239.4-1305s21c1
Sequence:CCGGGGACAACTACTGGATGCTCAACTCGAGTTGAGCATCCAGTAGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1931s21c1
Sequence:CCGGTGGAGACTCTGCTAGCTTGACCTCGAGGTCAAGCTAGCAGAGTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008239.4-2088s21c1
Sequence:CCGGCTCTCCATCAAATGTGCCTTACTCGAGTAAGGCACATTTGATGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008239.4-1164s21c1
Sequence:CCGGCGAGATCAACGAGTACCTCATCTCGAGATGAGGTACTCGTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033260
FOXQ1 MISSION shRNA Bacterial Glycerol Stock
forkhead box Q1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-688s1c1
Sequence:CCGGGCTGGCGGAGATCAACGAGTACTCGAGTACTCGTTGATCTCCGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-703s1c1
Sequence:CCGGCGAGTACCTCATGGGCAAGTTCTCGAGAACTTGCCCATGAGGTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-1443s1c1
Sequence:CCGGACCTGCCGTACCCGGTGGAGACTCGAGTCTCCACCGGGTACGGCAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-1068s1c1
Sequence:CCGGCCAGCTCCTTCGCCATCGACACTCGAGTGTCGATGGCGAAGGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-775s21c1
Sequence:CCGGCCTTTCGCTCAACGACTGCTTCTCGAGAAGCAGTCGTTGAGCGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033260.3-1796s21c1
Sequence:CCGGTGTCGCAACTTCCATTGATTTCTCGAGAAATCAATGGAAGTTGCGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-1461s21c1
Sequence:CCGGAGACGCTCCTAGCCTGAGTAGCTCGAGCTACTCAGGCTAGGAGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-588s21c1
Sequence:CCGGGTGCACGCAGCAAGCCATATACTCGAGTATATGGCTTGCTGCGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033260
FOXQ1 MISSION shRNA shRNA Plasmid DNA
forkhead box Q1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-688s1c1
Sequence:CCGGGCTGGCGGAGATCAACGAGTACTCGAGTACTCGTTGATCTCCGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-703s1c1
Sequence:CCGGCGAGTACCTCATGGGCAAGTTCTCGAGAACTTGCCCATGAGGTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-1443s1c1
Sequence:CCGGACCTGCCGTACCCGGTGGAGACTCGAGTCTCCACCGGGTACGGCAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-1068s1c1
Sequence:CCGGCCAGCTCCTTCGCCATCGACACTCGAGTGTCGATGGCGAAGGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-775s21c1
Sequence:CCGGCCTTTCGCTCAACGACTGCTTCTCGAGAAGCAGTCGTTGAGCGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033260.3-1796s21c1
Sequence:CCGGTGTCGCAACTTCCATTGATTTCTCGAGAAATCAATGGAAGTTGCGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-1461s21c1
Sequence:CCGGAGACGCTCCTAGCCTGAGTAGCTCGAGCTACTCAGGCTAGGAGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-588s21c1
Sequence:CCGGGTGCACGCAGCAAGCCATATACTCGAGTATATGGCTTGCTGCGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033260
FOXQ1 MISSION shRNA Lentiviral Transduction Particles
forkhead box Q1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-688s1c1
Sequence:CCGGGCTGGCGGAGATCAACGAGTACTCGAGTACTCGTTGATCTCCGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-703s1c1
Sequence:CCGGCGAGTACCTCATGGGCAAGTTCTCGAGAACTTGCCCATGAGGTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-1443s1c1
Sequence:CCGGACCTGCCGTACCCGGTGGAGACTCGAGTCTCCACCGGGTACGGCAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033260.2-1068s1c1
Sequence:CCGGCCAGCTCCTTCGCCATCGACACTCGAGTGTCGATGGCGAAGGAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-775s21c1
Sequence:CCGGCCTTTCGCTCAACGACTGCTTCTCGAGAAGCAGTCGTTGAGCGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033260.3-1796s21c1
Sequence:CCGGTGTCGCAACTTCCATTGATTTCTCGAGAAATCAATGGAAGTTGCGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-1461s21c1
Sequence:CCGGAGACGCTCCTAGCCTGAGTAGCTCGAGCTACTCAGGCTAGGAGCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033260.3-588s21c1
Sequence:CCGGGTGCACGCAGCAAGCCATATACTCGAGTATATGGCTTGCTGCGTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)