EMAIL THIS PAGE TO A FRIEND

FOXR1

forkhead box R1

49 Gene Product Result for
Synonyms: FOXN5
UniProtKB ID: Q6PIV2, B0YJ15, Q86UT9, Q8IXX2
Gene ID:
Human(283150) Summary: This gene encodes a member of the forkhead box (FOX) family of transcription factors. FOX family members are monomeric, helix-turn-helix proteins with a core DNA-binding domain of approximately 110 aa. Many FOX transcription factors play roles in determining cell fates during early development. This forkhead box protein lacks the C-terminal basic region found in many other FOX family members. It is located within the 11q23.3 region which is commonly deleted in neuroblastomas. [provided by RefSeq, Jul 2008]
Mouse(382074) forkhead box R1
Rat(315601) forkhead box R1
dog(489376) forkhead box R1
domestic cat(101093389) forkhead box R1
sheep(101114901) forkhead box R1
naked mole-rat(101725955) forkhead box R1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100856 Anti-FOXR1 antibody produced in rabbit affinity isolated antibody guinea pig, human
western blot pricing
SAB4501235 Anti-FOXR1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181721 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139121 MISSION® esiRNA esiRNA human FOXR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181721 Rosetta Predictions human pricing
XM_001067190 Rosetta Predictions rat pricing
XM_243815 Rosetta Predictions rat pricing
NM_001033469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165484 predicted 386
2 SASI_Hs01_00165485 predicted 865
3 SASI_Hs01_00165486 predicted 763
4 SASI_Hs01_00165487 predicted 759
5 SASI_Hs01_00165488 predicted 290
6 SASI_Hs02_00370331 predicted 563
7 SASI_Hs01_00165490 predicted 344
8 SASI_Hs01_00165491 predicted 800
9 SASI_Hs01_00165492 predicted 376
10 SASI_Hs01_00165493 predicted 816
11 SASI_Hs01_00165489 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320171 predicted 807
2 SASI_Rn02_00320172 predicted 380
3 SASI_Rn02_00320173 predicted 335
4 SASI_Rn02_00320174 predicted 318
5 SASI_Rn02_00320175 predicted 385
6 SASI_Rn02_00320176 predicted 320
7 SASI_Rn02_00320177 predicted 919
8 SASI_Rn02_00320178 predicted 578
9 SASI_Rn02_00320179 predicted 907
10 SASI_Rn02_00320180 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391759 predicted 803
2 SASI_Rn02_00391760 predicted 378
3 SASI_Rn02_00391761 predicted 335
4 SASI_Rn02_00391762 predicted 313
5 SASI_Rn02_00391763 predicted 379
6 SASI_Rn02_00391764 predicted 327
7 SASI_Rn02_00391765 predicted 916
8 SASI_Rn02_00391766 predicted 577
9 SASI_Rn02_00391767 predicted 900
10 SASI_Rn02_00391768 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061646 predicted 1183
2 SASI_Mm01_00061647 predicted 1209
3 SASI_Mm02_00288820 predicted 1122
4 SASI_Mm01_00061648 predicted 1117
5 SASI_Mm01_00061649 predicted 1200
6 SASI_Mm01_00061650 predicted 497
7 SASI_Mm01_00061651 predicted 1120
8 SASI_Mm01_00061652 predicted 1127
9 SASI_Mm01_00061653 predicted 1117
10 SASI_Mm01_00061654 predicted 1160
11 SASI_Mm01_00061645 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033469
FOXR1 MISSION shRNA Bacterial Glycerol Stock
forkhead box R1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-679s21c1
Sequence:CCGGCTCCTGGGTCGTTACAGTTTCCTCGAGGAAACTGTAACGACCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033469.2-1211s21c1
Sequence:CCGGCTTGGGTGGTTTAATCCTATTCTCGAGAATAGGATTAAACCACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-221s21c1
Sequence:CCGGTGAACCCAAACATGGTGTATCCTCGAGGATACACCATGTTTGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033469.2-1128s21c1
Sequence:GTACCGGCTTTCGCTTTGATAGTCATACCTCGAGGTATGACTATCAAAGCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-651s21c1
Sequence:CCGGCAATCCAGCTGTCCCTCAAATCTCGAGATTTGAGGGACAGCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-606s21c1
Sequence:CCGGACTCAGCGCTCAAGAACATAACTCGAGTTATGTTCTTGAGCGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-506s21c1
Sequence:CCGGTCCATTACTTCCATCTGATTGCTCGAGCAATCAGATGGAAGTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-188s21c1
Sequence:CCGGGTCCAGACATTAAGCCCAATCCTCGAGGATTGGGCTTAATGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-712s21c1
Sequence:CCGGCCCAAAGATTAGCCAGAATAGCTCGAGCTATTCTGGCTAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-565s21c1
Sequence:CCGGGTACAGCAGATCTACAGTTTCCTCGAGGAAACTGTAGATCTGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033469
FOXR1 MISSION shRNA shRNA Plasmid DNA
forkhead box R1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-679s21c1
Sequence:CCGGCTCCTGGGTCGTTACAGTTTCCTCGAGGAAACTGTAACGACCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033469.2-1211s21c1
Sequence:CCGGCTTGGGTGGTTTAATCCTATTCTCGAGAATAGGATTAAACCACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-221s21c1
Sequence:CCGGTGAACCCAAACATGGTGTATCCTCGAGGATACACCATGTTTGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033469.2-1128s21c1
Sequence:GTACCGGCTTTCGCTTTGATAGTCATACCTCGAGGTATGACTATCAAAGCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-651s21c1
Sequence:CCGGCAATCCAGCTGTCCCTCAAATCTCGAGATTTGAGGGACAGCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-606s21c1
Sequence:CCGGACTCAGCGCTCAAGAACATAACTCGAGTTATGTTCTTGAGCGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-506s21c1
Sequence:CCGGTCCATTACTTCCATCTGATTGCTCGAGCAATCAGATGGAAGTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-188s21c1
Sequence:CCGGGTCCAGACATTAAGCCCAATCCTCGAGGATTGGGCTTAATGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-712s21c1
Sequence:CCGGCCCAAAGATTAGCCAGAATAGCTCGAGCTATTCTGGCTAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-565s21c1
Sequence:CCGGGTACAGCAGATCTACAGTTTCCTCGAGGAAACTGTAGATCTGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033469
FOXR1 MISSION shRNA Lentiviral Transduction Particles
forkhead box R1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-679s21c1
Sequence:CCGGCTCCTGGGTCGTTACAGTTTCCTCGAGGAAACTGTAACGACCCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033469.2-1211s21c1
Sequence:CCGGCTTGGGTGGTTTAATCCTATTCTCGAGAATAGGATTAAACCACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-221s21c1
Sequence:CCGGTGAACCCAAACATGGTGTATCCTCGAGGATACACCATGTTTGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033469.2-1128s21c1
Sequence:GTACCGGCTTTCGCTTTGATAGTCATACCTCGAGGTATGACTATCAAAGCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-651s21c1
Sequence:CCGGCAATCCAGCTGTCCCTCAAATCTCGAGATTTGAGGGACAGCTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-606s21c1
Sequence:CCGGACTCAGCGCTCAAGAACATAACTCGAGTTATGTTCTTGAGCGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-506s21c1
Sequence:CCGGTCCATTACTTCCATCTGATTGCTCGAGCAATCAGATGGAAGTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-188s21c1
Sequence:CCGGGTCCAGACATTAAGCCCAATCCTCGAGGATTGGGCTTAATGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-712s21c1
Sequence:CCGGCCCAAAGATTAGCCAGAATAGCTCGAGCTATTCTGGCTAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033469.2-565s21c1
Sequence:CCGGGTACAGCAGATCTACAGTTTCCTCGAGGAAACTGTAGATCTGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181721
FOXR1 MISSION shRNA Bacterial Glycerol Stock
forkhead box R1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-349s1c1
Sequence:CCGGCCTGATAAGGATGGTCCAGATCTCGAGATCTGGACCATCCTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-748s1c1
Sequence:CCGGCCTCTCAATTACTTCCACCTACTCGAGTAGGTGGAAGTAATTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-303s1c1
Sequence:CCGGCCGAATTGTTAAGCCACCAAACTCGAGTTTGGTGGCTTAACAATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-773s1c1
Sequence:CCGGCCCTGGCATTAAGAAACAGTTCTCGAGAACTGTTTCTTAATGCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-289s1c1
Sequence:CCGGGCCAGGTATAAACTCCGAATTCTCGAGAATTCGGAGTTTATACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181721
FOXR1 MISSION shRNA shRNA Plasmid DNA
forkhead box R1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-349s1c1
Sequence:CCGGCCTGATAAGGATGGTCCAGATCTCGAGATCTGGACCATCCTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-748s1c1
Sequence:CCGGCCTCTCAATTACTTCCACCTACTCGAGTAGGTGGAAGTAATTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-303s1c1
Sequence:CCGGCCGAATTGTTAAGCCACCAAACTCGAGTTTGGTGGCTTAACAATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-773s1c1
Sequence:CCGGCCCTGGCATTAAGAAACAGTTCTCGAGAACTGTTTCTTAATGCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-289s1c1
Sequence:CCGGGCCAGGTATAAACTCCGAATTCTCGAGAATTCGGAGTTTATACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181721
FOXR1 MISSION shRNA Lentiviral Transduction Particles
forkhead box R1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-349s1c1
Sequence:CCGGCCTGATAAGGATGGTCCAGATCTCGAGATCTGGACCATCCTTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-748s1c1
Sequence:CCGGCCTCTCAATTACTTCCACCTACTCGAGTAGGTGGAAGTAATTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-303s1c1
Sequence:CCGGCCGAATTGTTAAGCCACCAAACTCGAGTTTGGTGGCTTAACAATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-773s1c1
Sequence:CCGGCCCTGGCATTAAGAAACAGTTCTCGAGAACTGTTTCTTAATGCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181721.1-289s1c1
Sequence:CCGGGCCAGGTATAAACTCCGAATTCTCGAGAATTCGGAGTTTATACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks