EMAIL THIS PAGE TO A FRIEND

FOXR2

forkhead box R2

93 Gene Product Result for
Synonyms: FOXN6
UniProtKB ID: Q6PJQ5
Gene ID:
Mouse(436240) forkhead box R2
Rat(302583) forkhead box R2
sheep(101115184) forkhead box R2
dog(100682939) forkhead box R2
cow(787976) forkhead box R2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198451 Rosetta Predictions human pricing
XM_001066252 Rosetta Predictions rat pricing
XM_228808 Rosetta Predictions rat pricing
NM_001034894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057153 predicted 1312
2 SASI_Hs01_00057154 predicted 1227
3 SASI_Hs01_00057156 predicted 1170
4 SASI_Hs01_00057157 predicted 1199
5 SASI_Hs01_00057158 predicted 352
6 SASI_Hs01_00057159 predicted 1226
7 SASI_Hs01_00057160 predicted 680
8 SASI_Hs01_00057161 predicted 841
9 SASI_Hs01_00057162 predicted 879
10 SASI_Hs02_00371964 predicted 1289
11 SASI_Hs01_00057155 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316824 predicted 563
2 SASI_Rn02_00316825 predicted 459
3 SASI_Rn02_00316826 predicted 280
4 SASI_Rn02_00316827 predicted 352
5 SASI_Rn02_00316828 predicted 419
6 SASI_Rn02_00316829 predicted 487
7 SASI_Rn02_00316830 predicted 228
8 SASI_Rn02_00316831 predicted 234
9 SASI_Rn02_00316832 predicted 600
10 SASI_Rn02_00316833 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385555 predicted 562
2 SASI_Rn02_00385556 predicted 460
3 SASI_Rn02_00385557 predicted 282
4 SASI_Rn02_00385558 predicted 356
5 SASI_Rn02_00385559 predicted 410
6 SASI_Rn02_00385560 predicted 485
7 SASI_Rn02_00385561 predicted 232
8 SASI_Rn02_00385562 predicted 232
9 SASI_Rn02_00385563 predicted 598
10 SASI_Rn02_00385564 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187752 predicted 866
2 SASI_Mm01_00187753 predicted 1065
3 SASI_Mm01_00187754 predicted 1502
4 SASI_Mm01_00187756 predicted 1395
5 SASI_Mm01_00187757 predicted 1295
6 SASI_Mm01_00187758 predicted 971
7 SASI_Mm01_00187761 predicted 1242
8 SASI_Mm02_00289166 predicted 976
9 SASI_Mm02_00289167 predicted 1062
10 SASI_Mm02_00289168 predicted 1274
11 SASI_Mm01_00187755 predicted 621
12 SASI_Mm01_00187759 predicted 1386
13 SASI_Mm01_00187760 predicted 1508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198451
FOXR2 MISSION shRNA Bacterial Glycerol Stock
forkhead box R2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-465s1c1
Sequence:CCGGGCCAAATACAGAGTCGGAGTACTCGAGTACTCCGACTCTGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1030s1c1
Sequence:CCGGGCTGGAAGAGCACCATTCATTCTCGAGAATGAATGGTGCTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1173s1c1
Sequence:CCGGGAGACTCGTGTCTTAGCCTTTCTCGAGAAAGGCTAAGACACGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158574    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198451.1-1526s1c1
Sequence:CCGGGCATAGAAACTAAGGAAAGAACTCGAGTTCTTTCCTTAGTTTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-869s1c1
Sequence:CCGGGCAAATCAACAACCAAGAGAACTCGAGTTCTCTTGGTTGTTGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-467s1c1
Sequence:CCGGCAAATACAGAGTCGGAGTAATCTCGAGATTACTCCGACTCTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1233s1c1
Sequence:CCGGGAGTTGTTGACCTCTCTCTTTCTCGAGAAAGAGAGAGGTCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198451.2-1017s21c1
Sequence:CCGGCTGGAAGAGCACCATTCATTACTCGAGTAATGAATGGTGCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198451.2-1279s21c1
Sequence:CCGGTTCCTTACTGTGCCTACTTATCTCGAGATAAGTAGGCACAGTAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198451
FOXR2 MISSION shRNA shRNA Plasmid DNA
forkhead box R2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-465s1c1
Sequence:CCGGGCCAAATACAGAGTCGGAGTACTCGAGTACTCCGACTCTGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1030s1c1
Sequence:CCGGGCTGGAAGAGCACCATTCATTCTCGAGAATGAATGGTGCTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1173s1c1
Sequence:CCGGGAGACTCGTGTCTTAGCCTTTCTCGAGAAAGGCTAAGACACGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158574    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198451.1-1526s1c1
Sequence:CCGGGCATAGAAACTAAGGAAAGAACTCGAGTTCTTTCCTTAGTTTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-869s1c1
Sequence:CCGGGCAAATCAACAACCAAGAGAACTCGAGTTCTCTTGGTTGTTGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-467s1c1
Sequence:CCGGCAAATACAGAGTCGGAGTAATCTCGAGATTACTCCGACTCTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1233s1c1
Sequence:CCGGGAGTTGTTGACCTCTCTCTTTCTCGAGAAAGAGAGAGGTCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198451.2-1017s21c1
Sequence:CCGGCTGGAAGAGCACCATTCATTACTCGAGTAATGAATGGTGCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198451.2-1279s21c1
Sequence:CCGGTTCCTTACTGTGCCTACTTATCTCGAGATAAGTAGGCACAGTAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198451
FOXR2 MISSION shRNA Lentiviral Transduction Particles
forkhead box R2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-465s1c1
Sequence:CCGGGCCAAATACAGAGTCGGAGTACTCGAGTACTCCGACTCTGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1030s1c1
Sequence:CCGGGCTGGAAGAGCACCATTCATTCTCGAGAATGAATGGTGCTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1173s1c1
Sequence:CCGGGAGACTCGTGTCTTAGCCTTTCTCGAGAAAGGCTAAGACACGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158574    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198451.1-1526s1c1
Sequence:CCGGGCATAGAAACTAAGGAAAGAACTCGAGTTCTTTCCTTAGTTTCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-869s1c1
Sequence:CCGGGCAAATCAACAACCAAGAGAACTCGAGTTCTCTTGGTTGTTGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-467s1c1
Sequence:CCGGCAAATACAGAGTCGGAGTAATCTCGAGATTACTCCGACTCTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198451.1-1233s1c1
Sequence:CCGGGAGTTGTTGACCTCTCTCTTTCTCGAGAAAGAGAGAGGTCAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198451.2-1017s21c1
Sequence:CCGGCTGGAAGAGCACCATTCATTACTCGAGTAATGAATGGTGCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198451.2-1279s21c1
Sequence:CCGGTTCCTTACTGTGCCTACTTATCTCGAGATAAGTAGGCACAGTAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034894
FOXR2 MISSION shRNA Bacterial Glycerol Stock
forkhead box R2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-677s1c1
Sequence:CCGGGCACTGCCTCAGAAGAAGAAACTCGAGTTTCTTCTTCTGAGGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-683s1c1
Sequence:CCGGCCTCAGAAGAAGAAATCCAATCTCGAGATTGGATTTCTTCTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034894.1-2996s1c1
Sequence:CCGGCCAAACATTCAATGAGAGTATCTCGAGATACTCTCATTGAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-1298s1c1
Sequence:CCGGGATGAGGGAAACCGATTCTTTCTCGAGAAAGAATCGGTTTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034894
FOXR2 MISSION shRNA shRNA Plasmid DNA
forkhead box R2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-677s1c1
Sequence:CCGGGCACTGCCTCAGAAGAAGAAACTCGAGTTTCTTCTTCTGAGGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-683s1c1
Sequence:CCGGCCTCAGAAGAAGAAATCCAATCTCGAGATTGGATTTCTTCTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034894.1-2996s1c1
Sequence:CCGGCCAAACATTCAATGAGAGTATCTCGAGATACTCTCATTGAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-1298s1c1
Sequence:CCGGGATGAGGGAAACCGATTCTTTCTCGAGAAAGAATCGGTTTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034894
FOXR2 MISSION shRNA Lentiviral Transduction Particles
forkhead box R2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-677s1c1
Sequence:CCGGGCACTGCCTCAGAAGAAGAAACTCGAGTTTCTTCTTCTGAGGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-683s1c1
Sequence:CCGGCCTCAGAAGAAGAAATCCAATCTCGAGATTGGATTTCTTCTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034894.1-2996s1c1
Sequence:CCGGCCAAACATTCAATGAGAGTATCTCGAGATACTCTCATTGAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034894.1-1298s1c1
Sequence:CCGGGATGAGGGAAACCGATTCTTTCTCGAGAAAGAATCGGTTTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks