EMAIL THIS PAGE TO A FRIEND

FOXRED1

FAD-dependent oxidoreductase domain containing 1

49 Gene Product Result for
Synonyms: H17
UniProtKB ID: Q96CU9, B3KN84, B4DHU2, Q71MG0, Q9BU39, Q9UKY9
Gene ID:
Human(55572) Summary: This gene encodes a protein that contains a FAD-dependent oxidoreductase domain. The encoded protein is localized to the mitochondria and may function as a chaperone protein required for the function of mitochondrial complex I. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(235169) FAD-dependent oxidoreductase domain containing 1
Rat(315547) FAD-dependent oxidoreductase domain containing 1
Zebrafish(556387) FAD-dependent oxidoreductase domain containing 1
dog(489292) FAD-dependent oxidoreductase domain containing 1
cow(510097) FAD-dependent oxidoreductase domain containing 1
Horse(100072450) FAD-dependent oxidoreductase domain containing 1
domestic cat(101088429) FAD-dependent oxidoreductase domain containing 1
chicken(419712) FAD-dependent oxidoreductase domain containing 1
sheep(101114222) FAD-dependent oxidoreductase domain containing 1
Domestic Rabbit(100338957) FAD-dependent oxidoreductase domain containing 1
domestic guinea pig(100717382) FAD-dependent oxidoreductase domain containing 1
naked mole-rat(101714249) FAD-dependent oxidoreductase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017547 Rosetta Predictions human pricing
XM_235988 Rosetta Predictions rat pricing
NM_172291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130981 predicted 612
2 SASI_Hs01_00130982 predicted 376
3 SASI_Hs01_00130983 predicted 669
4 SASI_Hs01_00130984 predicted 797
5 SASI_Hs01_00130985 predicted 619
6 SASI_Hs01_00130986 predicted 394
7 SASI_Hs01_00130988 predicted 626
8 SASI_Hs01_00130989 predicted 312
9 SASI_Hs01_00130990 predicted 444
10 SASI_Hs02_00350180 predicted 317
11 SASI_Hs01_00130987 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389805 predicted 237
2 SASI_Rn02_00389806 predicted 308
3 SASI_Rn02_00389807 predicted 405
4 SASI_Rn02_00389808 predicted 395
5 SASI_Rn02_00389809 predicted 301
6 SASI_Rn02_00389810 predicted 404
7 SASI_Rn02_00389811 predicted 314
8 SASI_Rn02_00389812 predicted 208
9 SASI_Rn02_00389813 predicted 196
10 SASI_Rn02_00389814 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069472 predicted 431
2 SASI_Mm02_00343777 predicted 1055
3 SASI_Mm01_00069473 predicted 655
4 SASI_Mm01_00069474 predicted 1480
5 SASI_Mm01_00069475 predicted 1001
6 SASI_Mm01_00069477 predicted 1147
7 SASI_Mm01_00069478 predicted 616
8 SASI_Mm02_00343778 predicted 630
9 SASI_Mm01_00069480 predicted 877
10 SASI_Mm01_00069481 predicted 1073
11 SASI_Mm01_00069476 predicted 293
12 SASI_Mm01_00069479 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017547
VALIDATED
FOXRED1 MISSION shRNA Bacterial Glycerol Stock
FAD-dependent oxidoreductase domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017547.2-629s21c1
Sequence:CCGGGAACAAGTTTCCCTGGATAAACTCGAGTTTATCCAGGGAAACTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017547.2-1322s21c1
Sequence:CCGGCCCGCTAGTTGTCAACATGTACTCGAGTACATGTTGACAACTAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017547.2-1076s21c1
Sequence:CCGGAGACACCAGTGGAGCCTATTTCTCGAGAAATAGGCTCCACTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017547.2-398s21c1
Sequence:CCGGGCAGTTCTCATTGCCTGAGAACTCGAGTTCTCAGGCAATGAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017547.2-1550s21c1
Sequence:CCGGCTGTGTTCACAGCCTTGTTTGCTCGAGCAAACAAGGCTGTGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1184s1c1
Sequence:CCGGCCATGATTTCTTCCAGGACAACTCGAGTTGTCCTGGAAGAAATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017547.2-193s1c1
Sequence:CCGGCCTGTGATCTACTGCAAGACACTCGAGTGTCTTGCAGTAGATCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1322s1c1
Sequence:CCGGCCCGCTAGTTGTCAACATGTACTCGAGTACATGTTGACAACTAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-398s1c1
Sequence:CCGGGCAGTTCTCATTGCCTGAGAACTCGAGTTCTCAGGCAATGAGAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1549s1c1
Sequence:CCGGGCTGTGTTCACAGCCTTGTTTCTCGAGAAACAAGGCTGTGAACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017547
VALIDATED
FOXRED1 MISSION shRNA shRNA Plasmid DNA
FAD-dependent oxidoreductase domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017547.2-629s21c1
Sequence:CCGGGAACAAGTTTCCCTGGATAAACTCGAGTTTATCCAGGGAAACTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017547.2-1322s21c1
Sequence:CCGGCCCGCTAGTTGTCAACATGTACTCGAGTACATGTTGACAACTAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017547.2-1076s21c1
Sequence:CCGGAGACACCAGTGGAGCCTATTTCTCGAGAAATAGGCTCCACTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017547.2-398s21c1
Sequence:CCGGGCAGTTCTCATTGCCTGAGAACTCGAGTTCTCAGGCAATGAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017547.2-1550s21c1
Sequence:CCGGCTGTGTTCACAGCCTTGTTTGCTCGAGCAAACAAGGCTGTGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1184s1c1
Sequence:CCGGCCATGATTTCTTCCAGGACAACTCGAGTTGTCCTGGAAGAAATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017547.2-193s1c1
Sequence:CCGGCCTGTGATCTACTGCAAGACACTCGAGTGTCTTGCAGTAGATCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1322s1c1
Sequence:CCGGCCCGCTAGTTGTCAACATGTACTCGAGTACATGTTGACAACTAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-398s1c1
Sequence:CCGGGCAGTTCTCATTGCCTGAGAACTCGAGTTCTCAGGCAATGAGAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1549s1c1
Sequence:CCGGGCTGTGTTCACAGCCTTGTTTCTCGAGAAACAAGGCTGTGAACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017547
VALIDATED
FOXRED1 MISSION shRNA Lentiviral Transduction Particles
FAD-dependent oxidoreductase domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017547.2-629s21c1
Sequence:CCGGGAACAAGTTTCCCTGGATAAACTCGAGTTTATCCAGGGAAACTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017547.2-1322s21c1
Sequence:CCGGCCCGCTAGTTGTCAACATGTACTCGAGTACATGTTGACAACTAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017547.2-1076s21c1
Sequence:CCGGAGACACCAGTGGAGCCTATTTCTCGAGAAATAGGCTCCACTGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_017547.2-398s21c1
Sequence:CCGGGCAGTTCTCATTGCCTGAGAACTCGAGTTCTCAGGCAATGAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017547.2-1550s21c1
Sequence:CCGGCTGTGTTCACAGCCTTGTTTGCTCGAGCAAACAAGGCTGTGAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1184s1c1
Sequence:CCGGCCATGATTTCTTCCAGGACAACTCGAGTTGTCCTGGAAGAAATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017547.2-193s1c1
Sequence:CCGGCCTGTGATCTACTGCAAGACACTCGAGTGTCTTGCAGTAGATCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1322s1c1
Sequence:CCGGCCCGCTAGTTGTCAACATGTACTCGAGTACATGTTGACAACTAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-398s1c1
Sequence:CCGGGCAGTTCTCATTGCCTGAGAACTCGAGTTCTCAGGCAATGAGAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017547.2-1549s1c1
Sequence:CCGGGCTGTGTTCACAGCCTTGTTTCTCGAGAAACAAGGCTGTGAACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172291
VALIDATED
FOXRED1 MISSION shRNA Bacterial Glycerol Stock
FAD-dependent oxidoreductase domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-617s21c1
Sequence:CCGGCAGACCAAGTTTCCCTGGATACTCGAGTATCCAGGGAAACTTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-1065s21c1
Sequence:CCGGCAGACATTAGTGGAGTCTATTCTCGAGAATAGACTCCACTAATGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-1277s21c1
Sequence:CCGGGCTGGTTATTATGACTACAATCTCGAGATTGTAGTCATAATAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172291.1-1848s21c1
Sequence:CCGGGCACAGAACATTCTAGGATAACTCGAGTTATCCTAGAATGTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-867s21c1
Sequence:CCGGTGGAGTATCAACCAGTAGAATCTCGAGATTCTACTGGTTGATACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1848s1c1
Sequence:CCGGGCACAGAACATTCTAGGATAACTCGAGTTATCCTAGAATGTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-867s1c1
Sequence:CCGGTGGAGTATCAACCAGTAGAATCTCGAGATTCTACTGGTTGATACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1065s1c1
Sequence:CCGGCAGACATTAGTGGAGTCTATTCTCGAGAATAGACTCCACTAATGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1277s1c1
Sequence:CCGGGCTGGTTATTATGACTACAATCTCGAGATTGTAGTCATAATAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-617s1c1
Sequence:CCGGCAGACCAAGTTTCCCTGGATACTCGAGTATCCAGGGAAACTTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172291
VALIDATED
FOXRED1 MISSION shRNA shRNA Plasmid DNA
FAD-dependent oxidoreductase domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-617s21c1
Sequence:CCGGCAGACCAAGTTTCCCTGGATACTCGAGTATCCAGGGAAACTTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-1065s21c1
Sequence:CCGGCAGACATTAGTGGAGTCTATTCTCGAGAATAGACTCCACTAATGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-1277s21c1
Sequence:CCGGGCTGGTTATTATGACTACAATCTCGAGATTGTAGTCATAATAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172291.1-1848s21c1
Sequence:CCGGGCACAGAACATTCTAGGATAACTCGAGTTATCCTAGAATGTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-867s21c1
Sequence:CCGGTGGAGTATCAACCAGTAGAATCTCGAGATTCTACTGGTTGATACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1848s1c1
Sequence:CCGGGCACAGAACATTCTAGGATAACTCGAGTTATCCTAGAATGTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-867s1c1
Sequence:CCGGTGGAGTATCAACCAGTAGAATCTCGAGATTCTACTGGTTGATACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1065s1c1
Sequence:CCGGCAGACATTAGTGGAGTCTATTCTCGAGAATAGACTCCACTAATGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1277s1c1
Sequence:CCGGGCTGGTTATTATGACTACAATCTCGAGATTGTAGTCATAATAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-617s1c1
Sequence:CCGGCAGACCAAGTTTCCCTGGATACTCGAGTATCCAGGGAAACTTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172291
VALIDATED
FOXRED1 MISSION shRNA Lentiviral Transduction Particles
FAD-dependent oxidoreductase domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-617s21c1
Sequence:CCGGCAGACCAAGTTTCCCTGGATACTCGAGTATCCAGGGAAACTTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-1065s21c1
Sequence:CCGGCAGACATTAGTGGAGTCTATTCTCGAGAATAGACTCCACTAATGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-1277s21c1
Sequence:CCGGGCTGGTTATTATGACTACAATCTCGAGATTGTAGTCATAATAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172291.1-1848s21c1
Sequence:CCGGGCACAGAACATTCTAGGATAACTCGAGTTATCCTAGAATGTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172291.1-867s21c1
Sequence:CCGGTGGAGTATCAACCAGTAGAATCTCGAGATTCTACTGGTTGATACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1848s1c1
Sequence:CCGGGCACAGAACATTCTAGGATAACTCGAGTTATCCTAGAATGTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-867s1c1
Sequence:CCGGTGGAGTATCAACCAGTAGAATCTCGAGATTCTACTGGTTGATACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1065s1c1
Sequence:CCGGCAGACATTAGTGGAGTCTATTCTCGAGAATAGACTCCACTAATGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-1277s1c1
Sequence:CCGGGCTGGTTATTATGACTACAATCTCGAGATTGTAGTCATAATAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172291.1-617s1c1
Sequence:CCGGCAGACCAAGTTTCCCTGGATACTCGAGTATCCAGGGAAACTTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)