EMAIL THIS PAGE TO A FRIEND

FOXRED2

FAD-dependent oxidoreductase domain containing 2

70 Gene Product Result for
Synonyms: ERFAD
UniProtKB ID: Q8IWF2, B2RDI4, Q8N378, Q96BD1, Q9H5L5, Q9H6M8
Gene ID:
Mouse(239554) FAD-dependent oxidoreductase domain containing 2
Rat(315112) FAD-dependent oxidoreductase domain containing 2
naked mole-rat(101701946) FAD-dependent oxidoreductase domain containing 2
domestic guinea pig(100719419) FAD-dependent oxidoreductase domain containing 2
sheep(101121924) FAD-dependent oxidoreductase domain containing 2
Domestic Rabbit(100344468) FAD-dependent oxidoreductase domain containing 2
Zebrafish(767722) FAD-dependent oxidoreductase domain containing 2
dog(474518) FAD-dependent oxidoreductase domain containing 2
Horse(100069503) FAD-dependent oxidoreductase domain containing 2
cow(532871) FAD-dependent oxidoreductase domain containing 2
domestic cat(101094517) FAD-dependent oxidoreductase domain containing 2
chicken(418054) FAD-dependent oxidoreductase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024955 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102371 Rosetta Predictions human pricing
NM_024955 Rosetta Predictions human pricing
XM_001075890 Rosetta Predictions rat pricing
XM_235468 Rosetta Predictions rat pricing
NM_001017983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323023 predicted 1667
2 SASI_Hs02_00323024 predicted 789
3 SASI_Hs02_00323025 predicted 781
4 SASI_Hs02_00323026 predicted 420
5 SASI_Hs02_00323027 predicted 622
6 SASI_Hs02_00323028 predicted 1846
7 SASI_Hs02_00323029 predicted 1645
8 SASI_Hs02_00323030 predicted 1681
9 SASI_Hs02_00323031 predicted 675
10 SASI_Hs02_00323032 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167637 predicted 1706
2 SASI_Hs01_00167638 predicted 834
3 SASI_Hs01_00167639 predicted 822
4 SASI_Hs01_00167640 predicted 462
5 SASI_Hs02_00357615 predicted 659
6 SASI_Hs01_00167641 predicted 1886
7 SASI_Hs01_00167642 predicted 1685
8 SASI_Hs01_00167643 predicted 1721
9 SASI_Hs01_00167644 predicted 716
10 SASI_Hs01_00167645 predicted 1335
11 SASI_Hs01_00167646 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351408 predicted 755
2 SASI_Rn02_00351409 predicted 935
3 SASI_Rn02_00351410 predicted 1418
4 SASI_Rn02_00351411 predicted 455
5 SASI_Rn02_00351412 predicted 1489
6 SASI_Rn02_00351413 predicted 1883
7 SASI_Rn02_00351414 predicted 1201
8 SASI_Rn02_00351415 predicted 1681
9 SASI_Rn02_00351416 predicted 1142
10 SASI_Rn02_00351417 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389349 predicted 1371
2 SASI_Rn02_00389350 predicted 1409
3 SASI_Rn02_00389351 predicted 410
4 SASI_Rn02_00389352 predicted 753
5 SASI_Rn02_00389353 predicted 929
6 SASI_Rn02_00389354 predicted 276
7 SASI_Rn02_00389355 predicted 877
8 SASI_Rn02_00389356 predicted 653
9 SASI_Rn02_00389357 predicted 1279
10 SASI_Rn02_00389358 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152084 predicted 375
2 SASI_Mm01_00152085 predicted 1776
3 SASI_Mm01_00152086 predicted 1053
4 SASI_Mm01_00152087 predicted 2029
5 SASI_Mm01_00152090 predicted 1807
6 SASI_Mm01_00152091 predicted 2149
7 SASI_Mm02_00287526 predicted 746
8 SASI_Mm02_00287527 predicted 1113
9 SASI_Mm01_00152092 predicted 795
10 SASI_Mm01_00152093 predicted 871
11 SASI_Mm01_00152088 predicted 1834
12 SASI_Mm01_00152089 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017983
FOXRED2 MISSION shRNA Bacterial Glycerol Stock
FAD-dependent oxidoreductase domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1607s1c1
Sequence:CCGGGCCTGGATGTCTAACTTCCTTCTCGAGAAGGAAGTTAGACATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1808s1c1
Sequence:CCGGGACACAGATCTGCGTAGCTTTCTCGAGAAAGCTACGCAGATCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017983.1-3780s1c1
Sequence:CCGGGCCTCTCAAGTATTGGGATTACTCGAGTAATCCCAATACTTGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017983.1-4185s1c1
Sequence:CCGGCCTCTCTCAAAGAAACTTTAACTCGAGTTAAAGTTTCTTTGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1133s1c1
Sequence:CCGGCCACTGATCAAAGCCAGCTATCTCGAGATAGCTGGCTTTGATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017983
FOXRED2 MISSION shRNA shRNA Plasmid DNA
FAD-dependent oxidoreductase domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1607s1c1
Sequence:CCGGGCCTGGATGTCTAACTTCCTTCTCGAGAAGGAAGTTAGACATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1808s1c1
Sequence:CCGGGACACAGATCTGCGTAGCTTTCTCGAGAAAGCTACGCAGATCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017983.1-3780s1c1
Sequence:CCGGGCCTCTCAAGTATTGGGATTACTCGAGTAATCCCAATACTTGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017983.1-4185s1c1
Sequence:CCGGCCTCTCTCAAAGAAACTTTAACTCGAGTTAAAGTTTCTTTGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1133s1c1
Sequence:CCGGCCACTGATCAAAGCCAGCTATCTCGAGATAGCTGGCTTTGATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017983
FOXRED2 MISSION shRNA Lentiviral Transduction Particles
FAD-dependent oxidoreductase domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1607s1c1
Sequence:CCGGGCCTGGATGTCTAACTTCCTTCTCGAGAAGGAAGTTAGACATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1808s1c1
Sequence:CCGGGACACAGATCTGCGTAGCTTTCTCGAGAAAGCTACGCAGATCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017983.1-3780s1c1
Sequence:CCGGGCCTCTCAAGTATTGGGATTACTCGAGTAATCCCAATACTTGAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017983.1-4185s1c1
Sequence:CCGGCCTCTCTCAAAGAAACTTTAACTCGAGTTAAAGTTTCTTTGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017983.1-1133s1c1
Sequence:CCGGCCACTGATCAAAGCCAGCTATCTCGAGATAGCTGGCTTTGATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024955
FOXRED2 MISSION shRNA Bacterial Glycerol Stock
FAD-dependent oxidoreductase domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1165s1c1
Sequence:CCGGCCTCAGACTTAACTCGGGAAACTCGAGTTTCCCGAGTTAAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1075s1c1
Sequence:CCGGCGACAATGACAACTTTGCCATCTCGAGATGGCAAAGTTGTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1868s1c1
Sequence:CCGGGAGAACTGTTTGGACACCGATCTCGAGATCGGTGTCCAAACAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1679s1c1
Sequence:CCGGGCCTGGCAGTCTAACTTTCTTCTCGAGAAGAAAGTTAGACTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-643s1c1
Sequence:CCGGCCTCTTTGTAGCCACTGGTTTCTCGAGAAACCAGTGGCTACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024955.5-1610s21c1
Sequence:CCGGTTCGTCATCAACATGGAATATCTCGAGATATTCCATGTTGATGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024955.5-2157s21c1
Sequence:CCGGAGTCCGTCGATAGCAACAAAGCTCGAGCTTTGTTGCTATCGACGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024955.5-2576s21c1
Sequence:CCGGCATCCGCATCTTAAGAGTTTGCTCGAGCAAACTCTTAAGATGCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024955
FOXRED2 MISSION shRNA shRNA Plasmid DNA
FAD-dependent oxidoreductase domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1165s1c1
Sequence:CCGGCCTCAGACTTAACTCGGGAAACTCGAGTTTCCCGAGTTAAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1075s1c1
Sequence:CCGGCGACAATGACAACTTTGCCATCTCGAGATGGCAAAGTTGTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1868s1c1
Sequence:CCGGGAGAACTGTTTGGACACCGATCTCGAGATCGGTGTCCAAACAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1679s1c1
Sequence:CCGGGCCTGGCAGTCTAACTTTCTTCTCGAGAAGAAAGTTAGACTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-643s1c1
Sequence:CCGGCCTCTTTGTAGCCACTGGTTTCTCGAGAAACCAGTGGCTACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024955.5-1610s21c1
Sequence:CCGGTTCGTCATCAACATGGAATATCTCGAGATATTCCATGTTGATGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024955.5-2157s21c1
Sequence:CCGGAGTCCGTCGATAGCAACAAAGCTCGAGCTTTGTTGCTATCGACGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024955.5-2576s21c1
Sequence:CCGGCATCCGCATCTTAAGAGTTTGCTCGAGCAAACTCTTAAGATGCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024955
FOXRED2 MISSION shRNA Lentiviral Transduction Particles
FAD-dependent oxidoreductase domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1165s1c1
Sequence:CCGGCCTCAGACTTAACTCGGGAAACTCGAGTTTCCCGAGTTAAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1075s1c1
Sequence:CCGGCGACAATGACAACTTTGCCATCTCGAGATGGCAAAGTTGTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1868s1c1
Sequence:CCGGGAGAACTGTTTGGACACCGATCTCGAGATCGGTGTCCAAACAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-1679s1c1
Sequence:CCGGGCCTGGCAGTCTAACTTTCTTCTCGAGAAGAAAGTTAGACTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024955.4-643s1c1
Sequence:CCGGCCTCTTTGTAGCCACTGGTTTCTCGAGAAACCAGTGGCTACAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024955.5-1610s21c1
Sequence:CCGGTTCGTCATCAACATGGAATATCTCGAGATATTCCATGTTGATGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024955.5-2157s21c1
Sequence:CCGGAGTCCGTCGATAGCAACAAAGCTCGAGCTTTGTTGCTATCGACGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024955.5-2576s21c1
Sequence:CCGGCATCCGCATCTTAAGAGTTTGCTCGAGCAAACTCTTAAGATGCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks