EMAIL THIS PAGE TO A FRIEND

FOXS1

forkhead box S1

70 Gene Product Result for
Synonyms: FKHL18 FREAC10
UniProtKB ID: O43638, Q96D28
Gene ID:
Human(2307) Summary: The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
Mouse(14239) forkhead box S1
Rat(311547) forkhead box S1
chicken(428156) forkhead box S1
cow(540142) forkhead box S1
dog(485826) forkhead box S1
domestic cat(101095567) forkhead box S1
dog(100684507) forkhead box S1
sheep(101112153) forkhead box S1
naked mole-rat(101712107) forkhead box S1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004118 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089201 MISSION® esiRNA esiRNA targeting mouse Foxs1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004118 Rosetta Predictions human pricing
NM_001012091 Rosetta Predictions rat pricing
XM_575264 Rosetta Predictions rat pricing
NM_010226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106727 predicted 194
2 SASI_Hs01_00106728 predicted 359
3 SASI_Hs01_00106729 predicted 275
4 SASI_Hs01_00106730 predicted 593
5 SASI_Hs01_00106731 predicted 628
6 SASI_Hs01_00106732 predicted 278
7 SASI_Hs01_00106733 predicted 1025
8 SASI_Hs01_00106734 predicted 1028
9 SASI_Hs01_00106735 predicted 224
10 SASI_Hs02_00336963 predicted 1074
11 SASI_Hs01_00106726 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110734 predicted 546
2 SASI_Rn01_00110736 predicted 996
3 SASI_Rn01_00110738 predicted 409
4 SASI_Rn01_00110739 predicted 613
5 SASI_Rn02_00200221 predicted 607
6 SASI_Rn01_00110740 predicted 955
7 SASI_Rn01_00110741 predicted 302
8 SASI_Rn01_00110742 predicted 312
9 SASI_Rn02_00200222 predicted 605
10 SASI_Rn02_00200223 predicted 318
11 SASI_Rn01_00110733 predicted 240
12 SASI_Rn01_00110735 predicted 488
13 SASI_Rn01_00110737 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144704 predicted 1043
2 SASI_Rn01_00144705 predicted 995
3 SASI_Rn01_00144706 predicted 1005
4 SASI_Rn01_00144707 predicted 952
5 SASI_Rn01_00144708 predicted 994
6 SASI_Rn01_00144709 predicted 946
7 SASI_Rn01_00144710 predicted 991
8 SASI_Rn01_00144711 predicted 961
9 SASI_Rn01_00144712 predicted 991
10 SASI_Rn01_00144713 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144786 predicted 597
2 SASI_Mm01_00144787 predicted 1046
3 SASI_Mm01_00144788 predicted 820
4 SASI_Mm01_00144789 predicted 559
5 SASI_Mm01_00144790 predicted 647
6 SASI_Mm01_00144791 predicted 433
7 SASI_Mm01_00144793 predicted 988
8 SASI_Mm02_00318073 predicted 377
9 SASI_Mm02_00318074 predicted 847
10 SASI_Mm01_00144795 predicted 999
11 SASI_Mm01_00144792 predicted 206
12 SASI_Mm01_00144794 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010226
FOXS1 MISSION shRNA Bacterial Glycerol Stock
forkhead box S1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010226.2-1115s21c1
Sequence:CCGGAGACTCAGACTGGCTATATGACTCGAGTCATATAGCCAGTCTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010226.2-1088s21c1
Sequence:CCGGGTAGGGCTCCTGTCAACTGTTCTCGAGAACAGTTGACAGGAGCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010226.2-566s21c1
Sequence:CCGGCTTAAGCTTTGAGGGTCTGATCTCGAGATCAGACCCTCAAAGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010226.2-1002s21c1
Sequence:CCGGTCTGGCTATCCACTGGGATTACTCGAGTAATCCCAGTGGATAGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-654s1c1
Sequence:CCGGCAAAGAGATGTGCTCGGCAAACTCGAGTTTGCCGAGCACATCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-1041s1c1
Sequence:CCGGGACTCCGGGAATGTTCTTCTTCTCGAGAAGAAGAACATTCCCGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-825s1c1
Sequence:CCGGCCGGATGCAGACACTGAATTTCTCGAGAAATTCAGTGTCTGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-204s1c1
Sequence:CCGGTGGCATCTACCGCTACATCATCTCGAGATGATGTAGCGGTAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-454s1c1
Sequence:CCGGCCTGTCAAGATAGACCACAGACTCGAGTCTGTGGTCTATCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010226
FOXS1 MISSION shRNA shRNA Plasmid DNA
forkhead box S1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010226.2-1115s21c1
Sequence:CCGGAGACTCAGACTGGCTATATGACTCGAGTCATATAGCCAGTCTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010226.2-1088s21c1
Sequence:CCGGGTAGGGCTCCTGTCAACTGTTCTCGAGAACAGTTGACAGGAGCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010226.2-566s21c1
Sequence:CCGGCTTAAGCTTTGAGGGTCTGATCTCGAGATCAGACCCTCAAAGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010226.2-1002s21c1
Sequence:CCGGTCTGGCTATCCACTGGGATTACTCGAGTAATCCCAGTGGATAGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-654s1c1
Sequence:CCGGCAAAGAGATGTGCTCGGCAAACTCGAGTTTGCCGAGCACATCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-1041s1c1
Sequence:CCGGGACTCCGGGAATGTTCTTCTTCTCGAGAAGAAGAACATTCCCGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-825s1c1
Sequence:CCGGCCGGATGCAGACACTGAATTTCTCGAGAAATTCAGTGTCTGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-204s1c1
Sequence:CCGGTGGCATCTACCGCTACATCATCTCGAGATGATGTAGCGGTAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-454s1c1
Sequence:CCGGCCTGTCAAGATAGACCACAGACTCGAGTCTGTGGTCTATCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010226
FOXS1 MISSION shRNA Lentiviral Transduction Particles
forkhead box S1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010226.2-1115s21c1
Sequence:CCGGAGACTCAGACTGGCTATATGACTCGAGTCATATAGCCAGTCTGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010226.2-1088s21c1
Sequence:CCGGGTAGGGCTCCTGTCAACTGTTCTCGAGAACAGTTGACAGGAGCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010226.2-566s21c1
Sequence:CCGGCTTAAGCTTTGAGGGTCTGATCTCGAGATCAGACCCTCAAAGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010226.2-1002s21c1
Sequence:CCGGTCTGGCTATCCACTGGGATTACTCGAGTAATCCCAGTGGATAGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-654s1c1
Sequence:CCGGCAAAGAGATGTGCTCGGCAAACTCGAGTTTGCCGAGCACATCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-1041s1c1
Sequence:CCGGGACTCCGGGAATGTTCTTCTTCTCGAGAAGAAGAACATTCCCGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-825s1c1
Sequence:CCGGCCGGATGCAGACACTGAATTTCTCGAGAAATTCAGTGTCTGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-204s1c1
Sequence:CCGGTGGCATCTACCGCTACATCATCTCGAGATGATGTAGCGGTAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010226.1-454s1c1
Sequence:CCGGCCTGTCAAGATAGACCACAGACTCGAGTCTGTGGTCTATCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004118
FOXS1 MISSION shRNA Bacterial Glycerol Stock
forkhead box S1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-715s21c1
Sequence:CCGGTCATGCCCAGCGTTTGGCTTTCTCGAGAAAGCCAAACGCTGGGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-553s21c1
Sequence:CCGGGATCCCAAGGGCCTAAGCTTTCTCGAGAAAGCTTAGGCCCTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-825s21c1
Sequence:CCGGTCGGCTGCAGGCACTGAATTTCTCGAGAAATTCAGTGCCTGCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-210s1c1
Sequence:CCGGCCGCTACATCATGGGCCGATTCTCGAGAATCGGCCCATGATGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-283s1c1
Sequence:CCGGCTGTCACTCAACGAGTGCTTTCTCGAGAAAGCACTCGTTGAGTGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-1047s1c1
Sequence:CCGGAGGAATGTTCTTCTTTGAGTACTCGAGTACTCAAAGAAGAACATTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-651s1c1
Sequence:CCGGCAAAGAGATTTCCACGCCCAACTCGAGTTGGGCGTGGAAATCTCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-136s1c1
Sequence:CCGGTACAGCTACATCGCCCTTATTCTCGAGAATAAGGGCGATGTAGCTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004118
FOXS1 MISSION shRNA shRNA Plasmid DNA
forkhead box S1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-715s21c1
Sequence:CCGGTCATGCCCAGCGTTTGGCTTTCTCGAGAAAGCCAAACGCTGGGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-553s21c1
Sequence:CCGGGATCCCAAGGGCCTAAGCTTTCTCGAGAAAGCTTAGGCCCTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-825s21c1
Sequence:CCGGTCGGCTGCAGGCACTGAATTTCTCGAGAAATTCAGTGCCTGCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-210s1c1
Sequence:CCGGCCGCTACATCATGGGCCGATTCTCGAGAATCGGCCCATGATGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-283s1c1
Sequence:CCGGCTGTCACTCAACGAGTGCTTTCTCGAGAAAGCACTCGTTGAGTGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-1047s1c1
Sequence:CCGGAGGAATGTTCTTCTTTGAGTACTCGAGTACTCAAAGAAGAACATTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-651s1c1
Sequence:CCGGCAAAGAGATTTCCACGCCCAACTCGAGTTGGGCGTGGAAATCTCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-136s1c1
Sequence:CCGGTACAGCTACATCGCCCTTATTCTCGAGAATAAGGGCGATGTAGCTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004118
FOXS1 MISSION shRNA Lentiviral Transduction Particles
forkhead box S1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-715s21c1
Sequence:CCGGTCATGCCCAGCGTTTGGCTTTCTCGAGAAAGCCAAACGCTGGGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-553s21c1
Sequence:CCGGGATCCCAAGGGCCTAAGCTTTCTCGAGAAAGCTTAGGCCCTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004118.3-825s21c1
Sequence:CCGGTCGGCTGCAGGCACTGAATTTCTCGAGAAATTCAGTGCCTGCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-210s1c1
Sequence:CCGGCCGCTACATCATGGGCCGATTCTCGAGAATCGGCCCATGATGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-283s1c1
Sequence:CCGGCTGTCACTCAACGAGTGCTTTCTCGAGAAAGCACTCGTTGAGTGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-1047s1c1
Sequence:CCGGAGGAATGTTCTTCTTTGAGTACTCGAGTACTCAAAGAAGAACATTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-651s1c1
Sequence:CCGGCAAAGAGATTTCCACGCCCAACTCGAGTTGGGCGTGGAAATCTCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004118.3-136s1c1
Sequence:CCGGTACAGCTACATCGCCCTTATTCTCGAGAATAAGGGCGATGTAGCTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks