EMAIL THIS PAGE TO A FRIEND

FPGS

folylpolyglutamate synthase

99 Gene Product Result for
Gene ID:
Human(2356) Summary: This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. While several transcript variants may exist for this gene, the full-length natures of only two have been biologically validated to date. These two variants encode distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(14287) folylpolyglutamyl synthetase
Rat(687266) folylpolyglutamate synthase
Zebrafish(406746) folylpolyglutamate synthase
dog(609176) folylpolyglutamate synthase
Horse(100070426) folylpolyglutamate synthase
cow(505809) folylpolyglutamate synthase
domestic cat(101092966) folylpolyglutamate synthase
chicken(417227) folylpolyglutamate synthase
sheep(101101964) folylpolyglutamate synthase
Domestic Rabbit(100357704) folylpolyglutamate synthase
naked mole-rat(101720293) folylpolyglutamate synthase
domestic guinea pig(100725303) folylpolyglutamate synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018078 Rosetta Predictions human pricing
NM_004957 Rosetta Predictions human pricing
XM_001078256 Rosetta Predictions rat pricing
XM_001078273 Rosetta Predictions rat pricing
NM_010236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120966 predicted 401
2 SASI_Hs02_00306981 predicted 474
3 SASI_Hs02_00306982 predicted 397
4 SASI_Hs01_00120967 predicted 1327
5 SASI_Hs01_00120968 predicted 381
6 SASI_Hs01_00120970 predicted 2129
7 SASI_Hs01_00120971 predicted 1366
8 SASI_Hs01_00120972 predicted 1450
9 SASI_Hs01_00120973 predicted 847
10 SASI_Hs02_00306983 predicted 687
11 SASI_Hs01_00120969 predicted 1351
12 SASI_Hs01_00120974 predicted 1866
13 SASI_Hs01_00120975 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057483 predicted 416
2 SASI_Hs02_00338638 predicted 491
3 SASI_Hs02_00338639 predicted 407
4 SASI_Hs01_00057484 predicted 1340
5 SASI_Hs01_00057485 predicted 395
6 SASI_Hs01_00057487 predicted 2140
7 SASI_Hs01_00057488 predicted 1370
8 SASI_Hs01_00057489 predicted 1468
9 SASI_Hs01_00057490 predicted 859
10 SASI_Hs02_00338640 predicted 701
11 SASI_Hs01_00057486 predicted 1364
12 SASI_Hs01_00057491 predicted 1869
13 SASI_Hs01_00057492 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360136 predicted 1846
2 SASI_Rn02_00360137 predicted 1841
3 SASI_Rn02_00360138 predicted 1370
4 SASI_Rn02_00360139 predicted 494
5 SASI_Rn02_00360140 predicted 505
6 SASI_Rn02_00360141 predicted 229
7 SASI_Rn02_00360142 predicted 229
8 SASI_Rn02_00360143 predicted 1264
9 SASI_Rn02_00360144 predicted 314
10 SASI_Rn02_00360145 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360217 predicted 1807
2 SASI_Rn02_00360218 predicted 1810
3 SASI_Rn02_00360219 predicted 1331
4 SASI_Rn02_00360220 predicted 464
5 SASI_Rn02_00360221 predicted 461
6 SASI_Rn02_00360222 predicted 196
7 SASI_Rn02_00360223 predicted 1226
8 SASI_Rn02_00360224 predicted 275
9 SASI_Rn02_00360225 predicted 1120
10 SASI_Rn02_00360226 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113165 predicted 331
2 SASI_Mm01_00113166 predicted 409
3 SASI_Mm02_00318096 predicted 1862
4 SASI_Mm01_00113167 predicted 1824
5 SASI_Mm01_00113168 predicted 1773
6 SASI_Mm01_00113169 predicted 1864
7 SASI_Mm01_00113170 predicted 1843
8 SASI_Mm01_00113171 predicted 1734
9 SASI_Mm01_00113172 predicted 466
10 SASI_Mm01_00113173 predicted 726
11 SASI_Mm01_00113174 predicted 1691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004957
VALIDATED
FPGS MISSION shRNA Bacterial Glycerol Stock
folylpolyglutamate synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-1297s1c1
Sequence:CCGGCCAGTTTGACTATGCCGTCTTCTCGAGAAGACGGCATAGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-239s1c1
Sequence:CCGGTCAGACACAGTTGGAAGCCATCTCGAGATGGCTTCCAACTGTGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004957.2-361s1c1
Sequence:CCGGTCACGGAATGTATCCTCCGAACTCGAGTTCGGAGGATACATTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-144s1c1
Sequence:CCGGCCGAGCATGGAGTACCAGGATCTCGAGATCCTGGTACTCCATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-353s1c1
Sequence:CCGGCTGTGCCTTCACGGAATGTATCTCGAGATACATTCCGTGAAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-190s21c1
Sequence:CCGGATGCCGTGCGCATGCTCAATACTCGAGTATTGAGCATGCGCACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-1336s21c1
Sequence:CCGGAGCCCTGCCAGTTTGACTATGCTCGAGCATAGTCAAACTGGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-1273s21c1
Sequence:CCGGTTCGAGTCTTGCTCTTCAATGCTCGAGCATTGAAGAGCAAGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-415s21c1
Sequence:CCGGGCCTGAAGACGGGATTCTTTACTCGAGTAAAGAATCCCGTCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-2231s21c1
Sequence:CCGGAGGGTGGCTGGAGTGAATTAACTCGAGTTAATTCACTCCAGCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004957
VALIDATED
FPGS MISSION shRNA shRNA Plasmid DNA
folylpolyglutamate synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-1297s1c1
Sequence:CCGGCCAGTTTGACTATGCCGTCTTCTCGAGAAGACGGCATAGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-239s1c1
Sequence:CCGGTCAGACACAGTTGGAAGCCATCTCGAGATGGCTTCCAACTGTGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004957.2-361s1c1
Sequence:CCGGTCACGGAATGTATCCTCCGAACTCGAGTTCGGAGGATACATTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-144s1c1
Sequence:CCGGCCGAGCATGGAGTACCAGGATCTCGAGATCCTGGTACTCCATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-353s1c1
Sequence:CCGGCTGTGCCTTCACGGAATGTATCTCGAGATACATTCCGTGAAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-190s21c1
Sequence:CCGGATGCCGTGCGCATGCTCAATACTCGAGTATTGAGCATGCGCACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-1336s21c1
Sequence:CCGGAGCCCTGCCAGTTTGACTATGCTCGAGCATAGTCAAACTGGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-1273s21c1
Sequence:CCGGTTCGAGTCTTGCTCTTCAATGCTCGAGCATTGAAGAGCAAGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-415s21c1
Sequence:CCGGGCCTGAAGACGGGATTCTTTACTCGAGTAAAGAATCCCGTCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-2231s21c1
Sequence:CCGGAGGGTGGCTGGAGTGAATTAACTCGAGTTAATTCACTCCAGCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004957
VALIDATED
FPGS MISSION shRNA Lentiviral Transduction Particles
folylpolyglutamate synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-1297s1c1
Sequence:CCGGCCAGTTTGACTATGCCGTCTTCTCGAGAAGACGGCATAGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-239s1c1
Sequence:CCGGTCAGACACAGTTGGAAGCCATCTCGAGATGGCTTCCAACTGTGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004957.2-361s1c1
Sequence:CCGGTCACGGAATGTATCCTCCGAACTCGAGTTCGGAGGATACATTCCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-144s1c1
Sequence:CCGGCCGAGCATGGAGTACCAGGATCTCGAGATCCTGGTACTCCATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004957.2-353s1c1
Sequence:CCGGCTGTGCCTTCACGGAATGTATCTCGAGATACATTCCGTGAAGGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-190s21c1
Sequence:CCGGATGCCGTGCGCATGCTCAATACTCGAGTATTGAGCATGCGCACGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-1336s21c1
Sequence:CCGGAGCCCTGCCAGTTTGACTATGCTCGAGCATAGTCAAACTGGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-1273s21c1
Sequence:CCGGTTCGAGTCTTGCTCTTCAATGCTCGAGCATTGAAGAGCAAGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-415s21c1
Sequence:CCGGGCCTGAAGACGGGATTCTTTACTCGAGTAAAGAATCCCGTCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004957.4-2231s21c1
Sequence:CCGGAGGGTGGCTGGAGTGAATTAACTCGAGTTAATTCACTCCAGCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010236
FPGS MISSION shRNA Bacterial Glycerol Stock
folylpolyglutamate synthase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-468s1c1
Sequence:CCGGGCACTTCTGGTGCCTCTATAACTCGAGTTATAGAGGCACCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010236.1-1795s1c1
Sequence:CCGGGCCTTTCCACAGACTCTTATACTCGAGTATAAGAGTCTGTGGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-421s1c1
Sequence:CCGGCGGATTCGAATCAACGGGAAACTCGAGTTTCCCGTTGATTCGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-1224s1c1
Sequence:CCGGCGAAGTACACATCTTGCTCTTCTCGAGAAGAGCAAGATGTGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-1299s1c1
Sequence:CCGGCCAGTTTGACTACGCTGTCTTCTCGAGAAGACAGCGTAGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010236
FPGS MISSION shRNA shRNA Plasmid DNA
folylpolyglutamate synthase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-468s1c1
Sequence:CCGGGCACTTCTGGTGCCTCTATAACTCGAGTTATAGAGGCACCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010236.1-1795s1c1
Sequence:CCGGGCCTTTCCACAGACTCTTATACTCGAGTATAAGAGTCTGTGGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-421s1c1
Sequence:CCGGCGGATTCGAATCAACGGGAAACTCGAGTTTCCCGTTGATTCGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-1224s1c1
Sequence:CCGGCGAAGTACACATCTTGCTCTTCTCGAGAAGAGCAAGATGTGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-1299s1c1
Sequence:CCGGCCAGTTTGACTACGCTGTCTTCTCGAGAAGACAGCGTAGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010236
FPGS MISSION shRNA Lentiviral Transduction Particles
folylpolyglutamate synthase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-468s1c1
Sequence:CCGGGCACTTCTGGTGCCTCTATAACTCGAGTTATAGAGGCACCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010236.1-1795s1c1
Sequence:CCGGGCCTTTCCACAGACTCTTATACTCGAGTATAAGAGTCTGTGGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-421s1c1
Sequence:CCGGCGGATTCGAATCAACGGGAAACTCGAGTTTCCCGTTGATTCGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-1224s1c1
Sequence:CCGGCGAAGTACACATCTTGCTCTTCTCGAGAAGAGCAAGATGTGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010236.1-1299s1c1
Sequence:CCGGCCAGTTTGACTACGCTGTCTTCTCGAGAAGACAGCGTAGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks