EMAIL THIS PAGE TO A FRIEND

FPGT

fucose-1-phosphate guanylyltransferase

83 Gene Product Result for
Synonyms: GFPP
UniProtKB ID: O14772, A6NMH3, B4DRX2, B4E2Y7, E9PNQ2, Q8N5J7
Gene ID:
Human(8790) Summary: L-fucose is a key sugar in glycoproteins and other complex carbohydrates since it may be involved in many of the functional roles of these macromolecules, such as in cell-cell recognition. The fucosyl donor for these fucosylated oligosaccharides is GDP-beta-L-fucose. There are two alternate pathways for the biosynthesis of GDP-fucose; the major pathway converts GDP-alpha-D-mannose to GDP-beta-L-fucose. The protein encoded by this gene participates in an alternate pathway that is present in certain mammalian tissues, such as liver and kidney, and appears to function as a salvage pathway to reutilize L-fucose arising from the turnover of glycoproteins and glycolipids. This pathway involves the phosphorylation of L-fucose to form beta-L-fucose-1-phosphate, and then condensation of the beta-L-fucose-1-phosphate with GTP by fucose-1-phosphate guanylyltransferase to form GDP-beta-L-fucose. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream TNNI3 interacting kinase (TNNI3K) gene. [provided by RefSeq, Dec 2010]
Mouse(75540) fucose-1-phosphate guanylyltransferase
Rat(310935) fucose-1-phosphate guanylyltransferase
domestic guinea pig(100718633) fucose-1-phosphate guanylyltransferase
Domestic Rabbit(100533991) fucose-1-phosphate guanylyltransferase
Zebrafish(553792) fucose-1-phosphate guanylyltransferase
dog(100533995) fucose-1-phosphate guanylyltransferase
cow(100138313) fucose-1-phosphate guanylyltransferase
Horse(100533993) fucose-1-phosphate guanylyltransferase
domestic cat(101085816) fucose-1-phosphate guanylyltransferase
chicken(100533998) fucose-1-phosphate guanylyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003838 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154141 MISSION® esiRNA esiRNA targeting mouse Fpgt mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003838 Rosetta Predictions human pricing
NM_199494 Rosetta Predictions rat pricing
NM_029330 Rosetta Predictions mouse pricing
XM_001005515 Rosetta Predictions mouse pricing
XM_131241 Rosetta Predictions mouse pricing
XM_898574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120172 predicted 1535
2 SASI_Hs01_00120173 predicted 422
3 SASI_Hs02_00336408 predicted 912
4 SASI_Hs01_00120176 predicted 1391
5 SASI_Hs01_00120177 predicted 1703
6 SASI_Hs01_00120178 predicted 582
7 SASI_Hs01_00120179 predicted 1596
8 SASI_Hs02_00336409 predicted 1853
9 SASI_Hs01_00120180 predicted 941
10 SASI_Hs01_00120181 predicted 740
11 SASI_Hs01_00120174 predicted 1721
12 SASI_Hs01_00120175 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270260 predicted 708
2 SASI_Rn01_00075540 predicted 552
3 SASI_Rn01_00075541 predicted 298
4 SASI_Rn01_00075542 predicted 1175
5 SASI_Rn01_00075543 predicted 1372
6 SASI_Rn01_00075544 predicted 410
7 SASI_Rn01_00075545 predicted 360
8 SASI_Rn01_00075546 predicted 724
9 SASI_Rn01_00075547 predicted 942
10 SASI_Rn01_00075548 predicted 1190
11 SASI_Rn01_00075549 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335148 predicted 1643
2 SASI_Mm02_00335149 predicted 557
3 SASI_Mm02_00335150 predicted 1129
4 SASI_Mm02_00335151 predicted 1712
5 SASI_Mm02_00335152 predicted 1726
6 SASI_Mm02_00335153 predicted 1446
7 SASI_Mm02_00335154 predicted 1386
8 SASI_Mm02_00335155 predicted 1652
9 SASI_Mm02_00335156 predicted 1777
10 SASI_Mm02_00335157 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233012 predicted 768
2 SASI_Mm01_00233013 predicted 1164
3 SASI_Mm01_00233014 predicted 1343
4 SASI_Mm01_00233015 predicted 804
5 SASI_Mm01_00233016 predicted 915
6 SASI_Mm01_00233017 predicted 1161
7 SASI_Mm01_00233018 predicted 1403
8 SASI_Mm01_00233019 predicted 736
9 SASI_Mm01_00233020 predicted 806
10 SASI_Mm01_00233021 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220975 predicted 582
2 SASI_Mm01_00220976 predicted 1160
3 SASI_Mm01_00220977 predicted 625
4 SASI_Mm01_00220978 predicted 741
5 SASI_Mm01_00220979 predicted 337
6 SASI_Mm01_00220980 predicted 1229
7 SASI_Mm01_00220981 predicted 336
8 SASI_Mm01_00220982 predicted 909
9 SASI_Mm01_00220983 predicted 565
10 SASI_Mm01_00220984 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237130 predicted 219
2 SASI_Mm01_00237131 predicted 336
3 SASI_Mm01_00237132 predicted 491
4 SASI_Mm01_00237133 predicted 506
5 SASI_Mm01_00237134 predicted 529
6 SASI_Mm01_00237135 predicted 656
7 SASI_Mm01_00237136 predicted 546
8 SASI_Mm01_00237137 predicted 186
9 SASI_Mm01_00237138 predicted 500
10 SASI_Mm01_00237139 predicted 103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003838
VALIDATED
FPGT MISSION shRNA Bacterial Glycerol Stock
fucose-1-phosphate guanylyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1696s21c1
Sequence:CCGGATTCAGCCTGAATAGCTATAACTCGAGTTATAGCTATTCAGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1111s21c1
Sequence:CCGGCATTGGAACAACCGAAGAATACTCGAGTATTCTTCGGTTGTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-839s21c1
Sequence:CCGGGTCTACACAGATAGCCTATTTCTCGAGAAATAGGCTATCTGTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003838.2-2304s21c1
Sequence:CCGGTTCACTCAGTGCCCAATATATCTCGAGATATATTGGGCACTGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1536s21c1
Sequence:CCGGGCTTAGATGTTTGGAATCTTACTCGAGTAAGATTCCAAACATCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-452s1c1
Sequence:CCGGCCCATTTATCAGATGCTAGAACTCGAGTTCTAGCATCTGATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1536s1c1
Sequence:CCGGGCTTAGATGTTTGGAATCTTACTCGAGTAAGATTCCAAACATCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-309s1c1
Sequence:CCGGGTGCCCTTCAATGTTTGGAAACTCGAGTTTCCAAACATTGAAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1765s1c1
Sequence:CCGGGATAACTTACAGGGAACAAATCTCGAGATTTGTTCCCTGTAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1174s1c1
Sequence:CCGGCGGCTTACAGTCCATAACTTTCTCGAGAAAGTTATGGACTGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003838
VALIDATED
FPGT MISSION shRNA shRNA Plasmid DNA
fucose-1-phosphate guanylyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1696s21c1
Sequence:CCGGATTCAGCCTGAATAGCTATAACTCGAGTTATAGCTATTCAGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1111s21c1
Sequence:CCGGCATTGGAACAACCGAAGAATACTCGAGTATTCTTCGGTTGTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-839s21c1
Sequence:CCGGGTCTACACAGATAGCCTATTTCTCGAGAAATAGGCTATCTGTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003838.2-2304s21c1
Sequence:CCGGTTCACTCAGTGCCCAATATATCTCGAGATATATTGGGCACTGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1536s21c1
Sequence:CCGGGCTTAGATGTTTGGAATCTTACTCGAGTAAGATTCCAAACATCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-452s1c1
Sequence:CCGGCCCATTTATCAGATGCTAGAACTCGAGTTCTAGCATCTGATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1536s1c1
Sequence:CCGGGCTTAGATGTTTGGAATCTTACTCGAGTAAGATTCCAAACATCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-309s1c1
Sequence:CCGGGTGCCCTTCAATGTTTGGAAACTCGAGTTTCCAAACATTGAAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1765s1c1
Sequence:CCGGGATAACTTACAGGGAACAAATCTCGAGATTTGTTCCCTGTAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1174s1c1
Sequence:CCGGCGGCTTACAGTCCATAACTTTCTCGAGAAAGTTATGGACTGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003838
VALIDATED
FPGT MISSION shRNA Lentiviral Transduction Particles
fucose-1-phosphate guanylyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1696s21c1
Sequence:CCGGATTCAGCCTGAATAGCTATAACTCGAGTTATAGCTATTCAGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1111s21c1
Sequence:CCGGCATTGGAACAACCGAAGAATACTCGAGTATTCTTCGGTTGTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-839s21c1
Sequence:CCGGGTCTACACAGATAGCCTATTTCTCGAGAAATAGGCTATCTGTGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003838.2-2304s21c1
Sequence:CCGGTTCACTCAGTGCCCAATATATCTCGAGATATATTGGGCACTGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003838.2-1536s21c1
Sequence:CCGGGCTTAGATGTTTGGAATCTTACTCGAGTAAGATTCCAAACATCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-452s1c1
Sequence:CCGGCCCATTTATCAGATGCTAGAACTCGAGTTCTAGCATCTGATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1536s1c1
Sequence:CCGGGCTTAGATGTTTGGAATCTTACTCGAGTAAGATTCCAAACATCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-309s1c1
Sequence:CCGGGTGCCCTTCAATGTTTGGAAACTCGAGTTTCCAAACATTGAAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1765s1c1
Sequence:CCGGGATAACTTACAGGGAACAAATCTCGAGATTTGTTCCCTGTAAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003838.1-1174s1c1
Sequence:CCGGCGGCTTACAGTCCATAACTTTCTCGAGAAAGTTATGGACTGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029330
VALIDATED
FPGT MISSION shRNA Bacterial Glycerol Stock
fucose-1-phosphate guanylyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029330.2-439s21c1
Sequence:CCGGACTAGCCATGTACGTGGATTTCTCGAGAAATCCACGTACATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-1713s21c1
Sequence:CCGGTACAAGACATGCTAGCTTATACTCGAGTATAAGCTAGCATGTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029330.2-597s21c1
Sequence:CCGGGCACTACTCATGGAGTATTTGCTCGAGCAAATACTCCATGAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-658s21c1
Sequence:CCGGGTACAGGCAATGCTACCAATTCTCGAGAATTGGTAGCATTGCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-3079s21c1
Sequence:CCGGCTGGTTATGCGTACCTATTATCTCGAGATAATAGGTACGCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029330
VALIDATED
FPGT MISSION shRNA shRNA Plasmid DNA
fucose-1-phosphate guanylyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029330.2-439s21c1
Sequence:CCGGACTAGCCATGTACGTGGATTTCTCGAGAAATCCACGTACATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-1713s21c1
Sequence:CCGGTACAAGACATGCTAGCTTATACTCGAGTATAAGCTAGCATGTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029330.2-597s21c1
Sequence:CCGGGCACTACTCATGGAGTATTTGCTCGAGCAAATACTCCATGAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-658s21c1
Sequence:CCGGGTACAGGCAATGCTACCAATTCTCGAGAATTGGTAGCATTGCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-3079s21c1
Sequence:CCGGCTGGTTATGCGTACCTATTATCTCGAGATAATAGGTACGCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029330
VALIDATED
FPGT MISSION shRNA Lentiviral Transduction Particles
fucose-1-phosphate guanylyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029330.2-439s21c1
Sequence:CCGGACTAGCCATGTACGTGGATTTCTCGAGAAATCCACGTACATGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-1713s21c1
Sequence:CCGGTACAAGACATGCTAGCTTATACTCGAGTATAAGCTAGCATGTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029330.2-597s21c1
Sequence:CCGGGCACTACTCATGGAGTATTTGCTCGAGCAAATACTCCATGAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-658s21c1
Sequence:CCGGGTACAGGCAATGCTACCAATTCTCGAGAATTGGTAGCATTGCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029330.2-3079s21c1
Sequence:CCGGCTGGTTATGCGTACCTATTATCTCGAGATAATAGGTACGCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks