EMAIL THIS PAGE TO A FRIEND

FPR1

formyl peptide receptor 1

59 Gene Product Result for
Synonyms: FMLP FPR
Species: Human FPR1(2357), Mouse Fpr1(14293), Rat Fpr1(292409), domestic guinea pig Fpr1(100712629), naked mole-rat Fpr1(101707455)
UniProtKB ID: P21462, Q14939, Q7Z6A4, Q86U52, Q9NS48
Gene ID:
Human(2357) Summary: This gene encodes a G protein-coupled receptor of mammalian phagocytic cells that is a member of the G-protein coupled receptor 1 family. The protein mediates the response of phagocytic cells to invasion of the host by microorganisms and is important in host defense and inflammation.[provided by RefSeq, Jul 2010]
Mouse(14293) formyl peptide receptor 1
Rat(292409) formyl peptide receptor 1
domestic guinea pig(100712629) formyl peptide receptor 1
naked mole-rat(101707455) formyl peptide receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002029 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036761 MISSION® esiRNA esiRNA human FPR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002029 Rosetta Predictions human pricing
NM_001106216 Rosetta Predictions rat pricing
NM_013521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156268 predicted 888
2 SASI_Hs01_00156269 predicted 578
3 SASI_Hs02_00333049 predicted 565
4 SASI_Hs01_00156271 predicted 383
5 SASI_Hs01_00156272 predicted 872
6 SASI_Hs01_00156274 predicted 395
7 SASI_Hs01_00156277 predicted 694
8 SASI_Hs02_00333050 predicted 326
9 SASI_Hs02_00333051 predicted 586
10 SASI_Hs02_00333052 predicted 750
11 SASI_Hs01_00156270 predicted 930
12 SASI_Hs01_00156273 predicted 561
13 SASI_Hs01_00156275 predicted 921
14 SASI_Hs01_00156276 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216778 predicted 788
2 SASI_Rn02_00216779 predicted 430
3 SASI_Rn02_00216780 predicted 312
4 SASI_Rn02_00216781 predicted 467
5 SASI_Rn02_00216782 predicted 275
6 SASI_Rn02_00216783 predicted 799
7 SASI_Rn02_00216784 predicted 263
8 SASI_Rn02_00216785 predicted 297
9 SASI_Rn02_00216786 predicted 359
10 SASI_Rn02_00216787 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199795 predicted 363
2 SASI_Mm01_00199796 predicted 576
3 SASI_Mm01_00199797 predicted 823
4 SASI_Mm01_00199798 predicted 379
5 SASI_Mm01_00199799 predicted 399
6 SASI_Mm01_00199800 predicted 911
7 SASI_Mm01_00199801 predicted 995
8 SASI_Mm01_00199802 predicted 511
9 SASI_Mm01_00199803 predicted 750
10 SASI_Mm01_00199804 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013521
FPR1 MISSION shRNA Bacterial Glycerol Stock
formyl peptide receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-685s1c1
Sequence:CCGGGCCATTTGCTATGGGTTAATACTCGAGTATTAACCCATAGCAAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-93s1c1
Sequence:CCGGCGTTCTGGATGTCTTCTCATACTCGAGTATGAGAAGACATCCAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-469s1c1
Sequence:CCGGCCCTGGATTTGTGCATTTCTTCTCGAGAAGAAATGCACAAATCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-624s1c1
Sequence:CCGGGCTCACTGTCAGAGGAATCATCTCGAGATGATTCCTCTGACAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-814s1c1
Sequence:CCGGGCCCTCATATCCACAATCCAACTCGAGTTGGATTGTGGATATGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013521
FPR1 MISSION shRNA shRNA Plasmid DNA
formyl peptide receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-685s1c1
Sequence:CCGGGCCATTTGCTATGGGTTAATACTCGAGTATTAACCCATAGCAAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-93s1c1
Sequence:CCGGCGTTCTGGATGTCTTCTCATACTCGAGTATGAGAAGACATCCAGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-469s1c1
Sequence:CCGGCCCTGGATTTGTGCATTTCTTCTCGAGAAGAAATGCACAAATCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-624s1c1
Sequence:CCGGGCTCACTGTCAGAGGAATCATCTCGAGATGATTCCTCTGACAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-814s1c1
Sequence:CCGGGCCCTCATATCCACAATCCAACTCGAGTTGGATTGTGGATATGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013521
FPR1 MISSION shRNA Lentiviral Transduction Particles
formyl peptide receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-685s1c1
Sequence:CCGGGCCATTTGCTATGGGTTAATACTCGAGTATTAACCCATAGCAAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-93s1c1
Sequence:CCGGCGTTCTGGATGTCTTCTCATACTCGAGTATGAGAAGACATCCAGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-469s1c1
Sequence:CCGGCCCTGGATTTGTGCATTTCTTCTCGAGAAGAAATGCACAAATCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-624s1c1
Sequence:CCGGGCTCACTGTCAGAGGAATCATCTCGAGATGATTCCTCTGACAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013521.1-814s1c1
Sequence:CCGGGCCCTCATATCCACAATCCAACTCGAGTTGGATTGTGGATATGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002029
FPR1 MISSION shRNA Bacterial Glycerol Stock
formyl peptide receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002029.3-1183s1c1
Sequence:CCGGTCCAGCTTCGTCTCACCTTGACTCGAGTCAAGGTGAGACGAAGCTGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-899s1c1
Sequence:CCGGCCGTGAGTTATTGCAAGGCATCTCGAGATGCCTTGCAATAACTCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-557s1c1
Sequence:CCGGGCTCCTCACATTGCCAGTTATCTCGAGATAACTGGCAATGTGAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-395s1c1
Sequence:CCGGCGTCTTTACCATAGTGGACATCTCGAGATGTCCACTATGGTAAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-747s1c1
Sequence:CCGGGCTGTCAGTTATGGGCTTATTCTCGAGAATAAGCCCATAACTGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-748s21c1
Sequence:CCGGCTGTCAGTTATGGGCTTATTGCTCGAGCAATAAGCCCATAACTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-1087s21c1
Sequence:CCGGCCAGTGACACAGCTACCAATTCTCGAGAATTGGTAGCTGTGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-865s21c1
Sequence:CCGGATCAGGTGGTGGCCCTTATAGCTCGAGCTATAAGGGCCACCACCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002029
FPR1 MISSION shRNA shRNA Plasmid DNA
formyl peptide receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002029.3-1183s1c1
Sequence:CCGGTCCAGCTTCGTCTCACCTTGACTCGAGTCAAGGTGAGACGAAGCTGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-899s1c1
Sequence:CCGGCCGTGAGTTATTGCAAGGCATCTCGAGATGCCTTGCAATAACTCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-557s1c1
Sequence:CCGGGCTCCTCACATTGCCAGTTATCTCGAGATAACTGGCAATGTGAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-395s1c1
Sequence:CCGGCGTCTTTACCATAGTGGACATCTCGAGATGTCCACTATGGTAAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-747s1c1
Sequence:CCGGGCTGTCAGTTATGGGCTTATTCTCGAGAATAAGCCCATAACTGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-748s21c1
Sequence:CCGGCTGTCAGTTATGGGCTTATTGCTCGAGCAATAAGCCCATAACTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-1087s21c1
Sequence:CCGGCCAGTGACACAGCTACCAATTCTCGAGAATTGGTAGCTGTGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-865s21c1
Sequence:CCGGATCAGGTGGTGGCCCTTATAGCTCGAGCTATAAGGGCCACCACCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002029
FPR1 MISSION shRNA Lentiviral Transduction Particles
formyl peptide receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002029.3-1183s1c1
Sequence:CCGGTCCAGCTTCGTCTCACCTTGACTCGAGTCAAGGTGAGACGAAGCTGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-899s1c1
Sequence:CCGGCCGTGAGTTATTGCAAGGCATCTCGAGATGCCTTGCAATAACTCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-557s1c1
Sequence:CCGGGCTCCTCACATTGCCAGTTATCTCGAGATAACTGGCAATGTGAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-395s1c1
Sequence:CCGGCGTCTTTACCATAGTGGACATCTCGAGATGTCCACTATGGTAAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002029.3-747s1c1
Sequence:CCGGGCTGTCAGTTATGGGCTTATTCTCGAGAATAAGCCCATAACTGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-748s21c1
Sequence:CCGGCTGTCAGTTATGGGCTTATTGCTCGAGCAATAAGCCCATAACTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-1087s21c1
Sequence:CCGGCCAGTGACACAGCTACCAATTCTCGAGAATTGGTAGCTGTGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002029.3-865s21c1
Sequence:CCGGATCAGGTGGTGGCCCTTATAGCTCGAGCTATAAGGGCCACCACCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)