EMAIL THIS PAGE TO A FRIEND

FPR2

formyl peptide receptor 2

64 Gene Product Result for
Synonyms: ALXR FMLP-R-II FMLPX FPR2A FPRH1 FPRH2 FPRL1 HM63 LXA4R
UniProtKB ID: P25090, A8K3E2
Gene ID:
Mouse(14289) formyl peptide receptor 2
Rat(690158) formyl peptide receptor 2
dog(611696) formyl peptide receptor 2
domestic cat(101091916) formyl peptide receptor 2
naked mole-rat(101729001) formyl peptide receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001462 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017941 MISSION® esiRNA esiRNA targeting human FPR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005738 Rosetta Predictions human pricing
NM_001462 Rosetta Predictions human pricing
XM_001073508 Rosetta Predictions rat pricing
NM_008039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305005 predicted 382
2 SASI_Hs01_00117668 predicted 803
3 SASI_Hs01_00117669 predicted 646
4 SASI_Hs01_00117670 predicted 264
5 SASI_Hs01_00117671 predicted 645
6 SASI_Hs01_00117672 predicted 684
7 SASI_Hs01_00117673 predicted 843
8 SASI_Hs01_00117674 predicted 946
9 SASI_Hs01_00117675 predicted 1038
10 SASI_Hs01_00117676 predicted 325
11 SASI_Hs01_00117677 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331902 predicted 472
2 SASI_Hs01_00229165 predicted 905
3 SASI_Hs01_00229166 predicted 738
4 SASI_Hs01_00229167 predicted 361
5 SASI_Hs01_00229168 predicted 741
6 SASI_Hs01_00229169 predicted 786
7 SASI_Hs01_00229170 predicted 948
8 SASI_Hs01_00229171 predicted 1040
9 SASI_Hs01_00229172 predicted 1132
10 SASI_Hs01_00229173 predicted 422
11 SASI_Hs01_00229174 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343071 predicted 302
2 SASI_Rn02_00343072 predicted 574
3 SASI_Rn02_00343073 predicted 810
4 SASI_Rn02_00343074 predicted 711
5 SASI_Rn02_00343075 predicted 789
6 SASI_Rn02_00343076 predicted 803
7 SASI_Rn02_00343077 predicted 684
8 SASI_Rn02_00343078 predicted 287
9 SASI_Rn02_00343079 predicted 826
10 SASI_Rn02_00343080 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094342 predicted 923
2 SASI_Mm01_00094343 predicted 383
3 SASI_Mm01_00094344 predicted 686
4 SASI_Mm01_00094345 predicted 751
5 SASI_Mm01_00094346 predicted 621
6 SASI_Mm01_00094348 predicted 884
7 SASI_Mm01_00094349 predicted 772
8 SASI_Mm01_00094350 predicted 543
9 SASI_Mm02_00312995 predicted 748
10 SASI_Mm02_00312996 predicted 893
11 SASI_Mm01_00094347 predicted 544
12 SASI_Mm01_00094351 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008039
FPR2 MISSION shRNA Bacterial Glycerol Stock
formyl peptide receptor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-1010s21c1
Sequence:CCGGACTTTCGTGAGAGATTTATTCCTCGAGGAATAAATCTCTCACGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-692s21c1
Sequence:CCGGGGATCATCAGGTTCCTTATTGCTCGAGCAATAAGGAACCTGATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-608s21c1
Sequence:CCGGTGTATTGTACATTCAACTTTGCTCGAGCAAAGTTGAATGTACAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-684s1c1
Sequence:CCGGCAACAGAAGAAACCTTGTTAACTCGAGTTAACAAGGTTTCTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-855s1c1
Sequence:CCGGCCCAACAAGCTCATTGGCTTACTCGAGTAAGCCAATGAGCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-812s1c1
Sequence:CCGGCATTGCTTAGTGGTAGTTATACTCGAGTATAACTACCACTAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-652s1c1
Sequence:CCGGGCTGTTTGCTATGGACTCATTCTCGAGAATGAGTCCATAGCAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-310s1c1
Sequence:CCGGGTGGTAGATGTAAACCTGTTTCTCGAGAAACAGGTTTACATCTACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008039
FPR2 MISSION shRNA shRNA Plasmid DNA
formyl peptide receptor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-1010s21c1
Sequence:CCGGACTTTCGTGAGAGATTTATTCCTCGAGGAATAAATCTCTCACGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-692s21c1
Sequence:CCGGGGATCATCAGGTTCCTTATTGCTCGAGCAATAAGGAACCTGATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-608s21c1
Sequence:CCGGTGTATTGTACATTCAACTTTGCTCGAGCAAAGTTGAATGTACAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-684s1c1
Sequence:CCGGCAACAGAAGAAACCTTGTTAACTCGAGTTAACAAGGTTTCTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-855s1c1
Sequence:CCGGCCCAACAAGCTCATTGGCTTACTCGAGTAAGCCAATGAGCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-812s1c1
Sequence:CCGGCATTGCTTAGTGGTAGTTATACTCGAGTATAACTACCACTAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-652s1c1
Sequence:CCGGGCTGTTTGCTATGGACTCATTCTCGAGAATGAGTCCATAGCAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-310s1c1
Sequence:CCGGGTGGTAGATGTAAACCTGTTTCTCGAGAAACAGGTTTACATCTACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008039
FPR2 MISSION shRNA Lentiviral Transduction Particles
formyl peptide receptor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-1010s21c1
Sequence:CCGGACTTTCGTGAGAGATTTATTCCTCGAGGAATAAATCTCTCACGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-692s21c1
Sequence:CCGGGGATCATCAGGTTCCTTATTGCTCGAGCAATAAGGAACCTGATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008039.2-608s21c1
Sequence:CCGGTGTATTGTACATTCAACTTTGCTCGAGCAAAGTTGAATGTACAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-684s1c1
Sequence:CCGGCAACAGAAGAAACCTTGTTAACTCGAGTTAACAAGGTTTCTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-855s1c1
Sequence:CCGGCCCAACAAGCTCATTGGCTTACTCGAGTAAGCCAATGAGCTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-812s1c1
Sequence:CCGGCATTGCTTAGTGGTAGTTATACTCGAGTATAACTACCACTAAGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-652s1c1
Sequence:CCGGGCTGTTTGCTATGGACTCATTCTCGAGAATGAGTCCATAGCAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008039.1-310s1c1
Sequence:CCGGGTGGTAGATGTAAACCTGTTTCTCGAGAAACAGGTTTACATCTACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001462
FPR2 MISSION shRNA Bacterial Glycerol Stock
formyl peptide receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001462.3-1477s21c1
Sequence:CCGGTAGATGAGATAGCGCATAATACTCGAGTATTATGCGCTATCTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001462.3-424s21c1
Sequence:CCGGGCTGGTTCCTGTGTAAGTTAACTCGAGTTAACTTACACAGGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001462.3-1259s21c1
Sequence:CCGGCATCTACCCTTGAGTCATATTCTCGAGAATATGACTCAAGGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001462.3-754s21c1
Sequence:CCGGTCCGGTTTGTCATTGGCTTTACTCGAGTAAAGCCAATGACAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001462.1-1895s1c1
Sequence:CCGGCCTTGAGTCATATTGAGGCATCTCGAGATGCCTCAATATGACTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1582s1c1
Sequence:CCGGGATGTTGTTCTATGGCAAGTACTCGAGTACTTGCCATAGAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1804s1c1
Sequence:CCGGAGAGACTGAGTTACAGGCAATCTCGAGATTGCCTGTAACTCAGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1264s1c1
Sequence:CCGGGACTACAGTAACTATTCCAAACTCGAGTTTGGAATAGTTACTGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-998s1c1
Sequence:CCGGGCCACATTACCATTCCTCATTCTCGAGAATGAGGAATGGTAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001462
FPR2 MISSION shRNA shRNA Plasmid DNA
formyl peptide receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001462.3-1477s21c1
Sequence:CCGGTAGATGAGATAGCGCATAATACTCGAGTATTATGCGCTATCTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001462.3-424s21c1
Sequence:CCGGGCTGGTTCCTGTGTAAGTTAACTCGAGTTAACTTACACAGGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001462.3-1259s21c1
Sequence:CCGGCATCTACCCTTGAGTCATATTCTCGAGAATATGACTCAAGGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001462.3-754s21c1
Sequence:CCGGTCCGGTTTGTCATTGGCTTTACTCGAGTAAAGCCAATGACAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001462.1-1895s1c1
Sequence:CCGGCCTTGAGTCATATTGAGGCATCTCGAGATGCCTCAATATGACTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1582s1c1
Sequence:CCGGGATGTTGTTCTATGGCAAGTACTCGAGTACTTGCCATAGAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1804s1c1
Sequence:CCGGAGAGACTGAGTTACAGGCAATCTCGAGATTGCCTGTAACTCAGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1264s1c1
Sequence:CCGGGACTACAGTAACTATTCCAAACTCGAGTTTGGAATAGTTACTGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-998s1c1
Sequence:CCGGGCCACATTACCATTCCTCATTCTCGAGAATGAGGAATGGTAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001462
FPR2 MISSION shRNA Lentiviral Transduction Particles
formyl peptide receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001462.3-1477s21c1
Sequence:CCGGTAGATGAGATAGCGCATAATACTCGAGTATTATGCGCTATCTCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001462.3-424s21c1
Sequence:CCGGGCTGGTTCCTGTGTAAGTTAACTCGAGTTAACTTACACAGGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001462.3-1259s21c1
Sequence:CCGGCATCTACCCTTGAGTCATATTCTCGAGAATATGACTCAAGGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001462.3-754s21c1
Sequence:CCGGTCCGGTTTGTCATTGGCTTTACTCGAGTAAAGCCAATGACAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001462.1-1895s1c1
Sequence:CCGGCCTTGAGTCATATTGAGGCATCTCGAGATGCCTCAATATGACTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1582s1c1
Sequence:CCGGGATGTTGTTCTATGGCAAGTACTCGAGTACTTGCCATAGAACAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1804s1c1
Sequence:CCGGAGAGACTGAGTTACAGGCAATCTCGAGATTGCCTGTAACTCAGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-1264s1c1
Sequence:CCGGGACTACAGTAACTATTCCAAACTCGAGTTTGGAATAGTTACTGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001462.1-998s1c1
Sequence:CCGGGCCACATTACCATTCCTCATTCTCGAGAATGAGGAATGGTAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks