EMAIL THIS PAGE TO A FRIEND

FPR3

formyl peptide receptor 3

74 Gene Product Result for
Synonyms: FML2_HUMAN FMLPY FPRH1 FPRH2 FPRL2 RMLP-R-I
UniProtKB ID: P25089
Gene ID:
Mouse(14294) formyl peptide receptor 3
Rat(292413) formyl peptide receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002030 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008181 MISSION® esiRNA esiRNA targeting human FPR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002030 Rosetta Predictions human pricing
XM_001058175 Rosetta Predictions rat pricing
XM_218016 Rosetta Predictions rat pricing
NM_008042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149115 predicted 490
2 SASI_Hs01_00149116 predicted 814
3 SASI_Hs01_00149117 predicted 638
4 SASI_Hs02_00333053 predicted 863
5 SASI_Hs01_00149118 predicted 460
6 SASI_Hs01_00149119 predicted 636
7 SASI_Hs01_00149120 predicted 513
8 SASI_Hs01_00149121 predicted 1070
9 SASI_Hs01_00149123 predicted 947
10 SASI_Hs01_00149124 predicted 481
11 SASI_Hs01_00149122 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288847 predicted 684
2 SASI_Rn02_00288848 predicted 454
3 SASI_Rn02_00288849 predicted 796
4 SASI_Rn02_00288850 predicted 807
5 SASI_Rn02_00288851 predicted 641
6 SASI_Rn02_00288852 predicted 245
7 SASI_Rn02_00288853 predicted 287
8 SASI_Rn02_00288854 predicted 764
9 SASI_Rn02_00288855 predicted 686
10 SASI_Rn02_00288856 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377445 predicted 684
2 SASI_Rn02_00377446 predicted 451
3 SASI_Rn02_00377447 predicted 793
4 SASI_Rn02_00377448 predicted 815
5 SASI_Rn02_00377449 predicted 635
6 SASI_Rn02_00377450 predicted 244
7 SASI_Rn02_00377451 predicted 288
8 SASI_Rn02_00377452 predicted 762
9 SASI_Rn02_00377453 predicted 689
10 SASI_Rn02_00377454 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045164 predicted 996
2 SASI_Mm02_00312997 predicted 901
3 SASI_Mm02_00312998 predicted 613
4 SASI_Mm01_00045165 predicted 847
5 SASI_Mm01_00045166 predicted 608
6 SASI_Mm02_00312999 predicted 946
7 SASI_Mm01_00045167 predicted 930
8 SASI_Mm01_00045168 predicted 309
9 SASI_Mm01_00045169 predicted 646
10 SASI_Mm01_00045170 predicted 678
11 SASI_Mm01_00045171 predicted 949
12 SASI_Mm01_00045172 predicted 1074
13 SASI_Mm01_00045173 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008042
FPR3 MISSION shRNA Bacterial Glycerol Stock
formyl peptide receptor 3
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-718s1c1
Sequence:CCGGGCTATGGACTCATCACTACAACTCGAGTTGTAGTGATGAGTCCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-994s1c1
Sequence:CCGGGACTGATTCATTCCCTGTCTTCTCGAGAAGACAGGGAATGAATCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-871s1c1
Sequence:CCGGTGCAGTTTAGTGGTAGTTATACTCGAGTATAACTACCACTAAACTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-236s1c1
Sequence:CCGGCACCACTATCTGGTATCTGAACTCGAGTTCAGATACCAGATAGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-582s1c1
Sequence:CCGGCACTGTAGATTGAGCTTTGTACTCGAGTACAAAGCTCAATCTACAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-494s1c1
Sequence:CCGGCCTCTTCTTGACTACAGTTAGCTCGAGCTAACTGTAGTCAAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-846s1c1
Sequence:CCGGATTATTGGCAGGTTGGTTAATCTCGAGATTAACCAACCTGCCAATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-617s1c1
Sequence:CCGGGATCATCAGGTTCATTGTTAGCTCGAGCTAACAATGAACCTGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-1006s1c1
Sequence:CCGGTCAGTGATACAAGAACCAATTCTCGAGAATTGGTTCTTGTATCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-799s1c1
Sequence:CCGGTAGGCACAGTCTGGCTCAAAGCTCGAGCTTTGAGCCAGACTGTGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-1046s1c1
Sequence:CCGGCATTGAAATAAAGGCAATATGCTCGAGCATATTGCCTTTATTTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-987s1c1
Sequence:CCGGAGTGAGGACTCTGGTCATATCCTCGAGGATATGACCAGAGTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-926s1c1
Sequence:CCGGGGGCCAGGACTTTCAAGAAAGCTCGAGCTTTCTTGAAAGTCCTGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-322s1c1
Sequence:CCGGCAGTAGATGTAAACCTATTTGCTCGAGCAAATAGGTTTACATCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-49s1c1
Sequence:CCGGATGTGGTGATCTATGATTCTACTCGAGTAGAATCATAGATCACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008042
FPR3 MISSION shRNA shRNA Plasmid DNA
formyl peptide receptor 3
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-718s1c1
Sequence:CCGGGCTATGGACTCATCACTACAACTCGAGTTGTAGTGATGAGTCCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-994s1c1
Sequence:CCGGGACTGATTCATTCCCTGTCTTCTCGAGAAGACAGGGAATGAATCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-871s1c1
Sequence:CCGGTGCAGTTTAGTGGTAGTTATACTCGAGTATAACTACCACTAAACTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-236s1c1
Sequence:CCGGCACCACTATCTGGTATCTGAACTCGAGTTCAGATACCAGATAGTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-582s1c1
Sequence:CCGGCACTGTAGATTGAGCTTTGTACTCGAGTACAAAGCTCAATCTACAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-494s1c1
Sequence:CCGGCCTCTTCTTGACTACAGTTAGCTCGAGCTAACTGTAGTCAAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-846s1c1
Sequence:CCGGATTATTGGCAGGTTGGTTAATCTCGAGATTAACCAACCTGCCAATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-617s1c1
Sequence:CCGGGATCATCAGGTTCATTGTTAGCTCGAGCTAACAATGAACCTGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-1006s1c1
Sequence:CCGGTCAGTGATACAAGAACCAATTCTCGAGAATTGGTTCTTGTATCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-799s1c1
Sequence:CCGGTAGGCACAGTCTGGCTCAAAGCTCGAGCTTTGAGCCAGACTGTGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-1046s1c1
Sequence:CCGGCATTGAAATAAAGGCAATATGCTCGAGCATATTGCCTTTATTTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-987s1c1
Sequence:CCGGAGTGAGGACTCTGGTCATATCCTCGAGGATATGACCAGAGTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-926s1c1
Sequence:CCGGGGGCCAGGACTTTCAAGAAAGCTCGAGCTTTCTTGAAAGTCCTGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-322s1c1
Sequence:CCGGCAGTAGATGTAAACCTATTTGCTCGAGCAAATAGGTTTACATCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-49s1c1
Sequence:CCGGATGTGGTGATCTATGATTCTACTCGAGTAGAATCATAGATCACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008042
FPR3 MISSION shRNA Lentiviral Transduction Particles
formyl peptide receptor 3
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-718s1c1
Sequence:CCGGGCTATGGACTCATCACTACAACTCGAGTTGTAGTGATGAGTCCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-994s1c1
Sequence:CCGGGACTGATTCATTCCCTGTCTTCTCGAGAAGACAGGGAATGAATCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-871s1c1
Sequence:CCGGTGCAGTTTAGTGGTAGTTATACTCGAGTATAACTACCACTAAACTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-236s1c1
Sequence:CCGGCACCACTATCTGGTATCTGAACTCGAGTTCAGATACCAGATAGTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008042.1-582s1c1
Sequence:CCGGCACTGTAGATTGAGCTTTGTACTCGAGTACAAAGCTCAATCTACAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-494s1c1
Sequence:CCGGCCTCTTCTTGACTACAGTTAGCTCGAGCTAACTGTAGTCAAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-846s1c1
Sequence:CCGGATTATTGGCAGGTTGGTTAATCTCGAGATTAACCAACCTGCCAATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-617s1c1
Sequence:CCGGGATCATCAGGTTCATTGTTAGCTCGAGCTAACAATGAACCTGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-1006s1c1
Sequence:CCGGTCAGTGATACAAGAACCAATTCTCGAGAATTGGTTCTTGTATCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-799s1c1
Sequence:CCGGTAGGCACAGTCTGGCTCAAAGCTCGAGCTTTGAGCCAGACTGTGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-1046s1c1
Sequence:CCGGCATTGAAATAAAGGCAATATGCTCGAGCATATTGCCTTTATTTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-987s1c1
Sequence:CCGGAGTGAGGACTCTGGTCATATCCTCGAGGATATGACCAGAGTCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-926s1c1
Sequence:CCGGGGGCCAGGACTTTCAAGAAAGCTCGAGCTTTCTTGAAAGTCCTGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-322s1c1
Sequence:CCGGCAGTAGATGTAAACCTATTTGCTCGAGCAAATAGGTTTACATCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008042.2-49s1c1
Sequence:CCGGATGTGGTGATCTATGATTCTACTCGAGTAGAATCATAGATCACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002030
FPR3 MISSION shRNA Bacterial Glycerol Stock
formyl peptide receptor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-1078s1c1
Sequence:CCGGCCCAATTCTCTACGTCTTTATCTCGAGATAAAGACGTAGAGAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-793s1c1
Sequence:CCGGCCTCCACTTCATTATTGGCTTCTCGAGAAGCCAATAATGAAGTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002030.3-2085s1c1
Sequence:CCGGCCCAGTCCTAACTTCATTTAACTCGAGTTAAATGAAGTTAGGACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-253s1c1
Sequence:CCGGCGTTCTGTGGATCTTCTCATTCTCGAGAATGAGAAGATCCACAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-950s1c1
Sequence:CCGGCCTTATGAACTAATTGGCATTCTCGAGAATGCCAATTAGTTCATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002030.3-646s21c1
Sequence:CCGGAGTCCTTACCTTACCAAATTTCTCGAGAAATTTGGTAAGGTAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002030.3-1635s21c1
Sequence:CCGGTTTCGGCTTGCTGGTTTATTACTCGAGTAATAAACCAGCAAGCCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002030.3-1077s21c1
Sequence:CCGGACCCAATTCTCTACGTCTTTACTCGAGTAAAGACGTAGAGAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002030
FPR3 MISSION shRNA shRNA Plasmid DNA
formyl peptide receptor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-1078s1c1
Sequence:CCGGCCCAATTCTCTACGTCTTTATCTCGAGATAAAGACGTAGAGAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-793s1c1
Sequence:CCGGCCTCCACTTCATTATTGGCTTCTCGAGAAGCCAATAATGAAGTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002030.3-2085s1c1
Sequence:CCGGCCCAGTCCTAACTTCATTTAACTCGAGTTAAATGAAGTTAGGACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-253s1c1
Sequence:CCGGCGTTCTGTGGATCTTCTCATTCTCGAGAATGAGAAGATCCACAGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-950s1c1
Sequence:CCGGCCTTATGAACTAATTGGCATTCTCGAGAATGCCAATTAGTTCATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002030.3-646s21c1
Sequence:CCGGAGTCCTTACCTTACCAAATTTCTCGAGAAATTTGGTAAGGTAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002030.3-1635s21c1
Sequence:CCGGTTTCGGCTTGCTGGTTTATTACTCGAGTAATAAACCAGCAAGCCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002030.3-1077s21c1
Sequence:CCGGACCCAATTCTCTACGTCTTTACTCGAGTAAAGACGTAGAGAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002030
FPR3 MISSION shRNA Lentiviral Transduction Particles
formyl peptide receptor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-1078s1c1
Sequence:CCGGCCCAATTCTCTACGTCTTTATCTCGAGATAAAGACGTAGAGAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-793s1c1
Sequence:CCGGCCTCCACTTCATTATTGGCTTCTCGAGAAGCCAATAATGAAGTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002030.3-2085s1c1
Sequence:CCGGCCCAGTCCTAACTTCATTTAACTCGAGTTAAATGAAGTTAGGACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-253s1c1
Sequence:CCGGCGTTCTGTGGATCTTCTCATTCTCGAGAATGAGAAGATCCACAGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002030.3-950s1c1
Sequence:CCGGCCTTATGAACTAATTGGCATTCTCGAGAATGCCAATTAGTTCATAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002030.3-646s21c1
Sequence:CCGGAGTCCTTACCTTACCAAATTTCTCGAGAAATTTGGTAAGGTAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002030.3-1635s21c1
Sequence:CCGGTTTCGGCTTGCTGGTTTATTACTCGAGTAATAAACCAGCAAGCCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002030.3-1077s21c1
Sequence:CCGGACCCAATTCTCTACGTCTTTACTCGAGTAAAGACGTAGAGAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)