EMAIL THIS PAGE TO A FRIEND

FRA10AC1

fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1

97 Gene Product Result for
Synonyms: C10orf4 F26C11.1-like FRA10A
Gene ID:
Human(118924) Summary: The protein encoded by this gene is a nuclear phosphoprotein of unknown function. The 5' UTR of this gene is part of a CpG island and contains a tandem CGG repeat region that normally consists of 8-14 repeats but can expand to over 200 repeats. The expanded allele becomes hypermethylated and is not transcribed; however, an expanded repeat region has not been associated with any disease phenotype. This gene is found within the rare FRA10A folate-sensitive fragile site. [provided by RefSeq, Mar 2010]
Mouse(70567) FRA10AC1 homolog (human)
Rat(365458) fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Zebrafish(449836) fragile site, folic acid type, rare, candidate 1
chicken(423803) fragile site, folic acid type, rare, fra candidate 1
domestic cat(101087786) fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
cow(615724) fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
dog(477776) fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
sheep(101105041) fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
naked mole-rat(101703188) fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145246 Rosetta Predictions human pricing
NM_203438 Rosetta Predictions human pricing
NM_203439 Rosetta Predictions human pricing
NM_203440 Rosetta Predictions human pricing
NM_203441 Rosetta Predictions human pricing
NM_001014246 Rosetta Predictions rat pricing
NM_001081075 Rosetta Predictions mouse pricing
XM_129261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092988 predicted 402
2 SASI_Hs01_00092989 predicted 398
3 SASI_Hs01_00092990 predicted 350
4 SASI_Hs01_00092991 predicted 631
5 SASI_Hs01_00092992 predicted 626
6 SASI_Hs01_00092993 predicted 584
7 SASI_Hs01_00092994 predicted 407
8 SASI_Hs01_00092995 predicted 586
9 SASI_Hs02_00365087 predicted 1194
10 SASI_Hs01_00092996 predicted 402
11 SASI_Hs01_00092997 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170629 predicted 415
2 SASI_Hs01_00170630 predicted 405
3 SASI_Hs01_00170631 predicted 355
4 SASI_Hs01_00170632 predicted 640
5 SASI_Hs01_00170633 predicted 632
6 SASI_Hs01_00170634 predicted 589
7 SASI_Hs01_00170635 predicted 418
8 SASI_Hs01_00170636 predicted 585
9 SASI_Hs01_00170637 predicted 417
10 SASI_Hs01_00170638 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036736 predicted 415
2 SASI_Hs01_00036737 predicted 405
3 SASI_Hs01_00036738 predicted 353
4 SASI_Hs01_00036739 predicted 636
5 SASI_Hs01_00036740 predicted 632
6 SASI_Hs01_00036741 predicted 587
7 SASI_Hs01_00036742 predicted 417
8 SASI_Hs01_00036743 predicted 586
9 SASI_Hs01_00036744 predicted 417
10 SASI_Hs01_00036745 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225135 predicted 416
2 SASI_Hs01_00225136 predicted 411
3 SASI_Hs01_00225137 predicted 358
4 SASI_Hs01_00225138 predicted 639
5 SASI_Hs01_00225139 predicted 624
6 SASI_Hs01_00225140 predicted 593
7 SASI_Hs01_00225141 predicted 417
8 SASI_Hs01_00225142 predicted 588
9 SASI_Hs01_00225143 predicted 407
10 SASI_Hs01_00225144 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165241 predicted 409
2 SASI_Hs01_00165242 predicted 402
3 SASI_Hs01_00165243 predicted 355
4 SASI_Hs01_00165244 predicted 632
5 SASI_Hs01_00165245 predicted 626
6 SASI_Hs01_00165246 predicted 597
7 SASI_Hs01_00165247 predicted 420
8 SASI_Hs01_00165248 predicted 591
9 SASI_Hs01_00165249 predicted 416
10 SASI_Hs01_00165250 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075745 predicted 349
2 SASI_Rn01_00075746 predicted 284
3 SASI_Rn01_00075747 predicted 439
4 SASI_Rn01_00075748 predicted 265
5 SASI_Rn01_00075749 predicted 266
6 SASI_Rn01_00075750 predicted 590
7 SASI_Rn01_00075751 predicted 218
8 SASI_Rn01_00075752 predicted 548
9 SASI_Rn01_00075753 predicted 1134
10 SASI_Rn01_00075754 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294931 predicted 778
2 SASI_Mm02_00294932 predicted 767
3 SASI_Mm02_00294933 predicted 970
4 SASI_Mm02_00294934 predicted 841
5 SASI_Mm02_00294935 predicted 560
6 SASI_Mm02_00294936 predicted 1108
7 SASI_Mm02_00294937 predicted 398
8 SASI_Mm02_00294938 predicted 250
9 SASI_Mm02_00294939 predicted 534
10 SASI_Mm02_00294940 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268555 predicted 785
2 SASI_Mm01_00268556 predicted 771
3 SASI_Mm01_00268557 predicted 974
4 SASI_Mm01_00268558 predicted 849
5 SASI_Mm01_00268559 predicted 569
6 SASI_Mm01_00268560 predicted 1112
7 SASI_Mm01_00268561 predicted 403
8 SASI_Mm01_00268562 predicted 254
9 SASI_Mm01_00268563 predicted 543
10 SASI_Mm01_00268564 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145246
VALIDATED
FRA10AC1 MISSION shRNA Bacterial Glycerol Stock
fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1306s21c1
Sequence:CCGGTGGAAGTTCATTAGTTCAATTCTCGAGAATTGAACTAATGAACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1329s21c1
Sequence:CCGGAGACTTTCCTGTCCTTTAAATCTCGAGATTTAAAGGACAGGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145246.3-504s21c1
Sequence:CCGGCAAGACAGACTTGGATGTTATCTCGAGATAACATCCAAGTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1414s21c1
Sequence:CCGGGATTCCATTGTTCCTACATTTCTCGAGAAATGTAGGAACAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-355s1c1
Sequence:CCGGGCAGAATTGCTGGATAGGGAACTCGAGTTCCCTATCCAGCAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145246.2-1021s1c1
Sequence:CCGGCTTAGAAACTCTGATGAGGAACTCGAGTTCCTCATCAGAGTTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-283s1c1
Sequence:CCGGGAAGATGACTTACTGCTCCAACTCGAGTTGGAGCAGTAAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-421s1c1
Sequence:CCGGCAAAGACATACAAAGTTCGTACTCGAGTACGAACTTTGTATGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-1007s1c1
Sequence:CCGGCTGAAGATTCTCTACTTAGAACTCGAGTTCTAAGTAGAGAATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-629s1c1
Sequence:CCGGGCATAGCAGATCTCAGTAAATCTCGAGATTTACTGAGATCTGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-798s1c1
Sequence:CCGGGAAGAGAAATGCACTTGTTAACTCGAGTTAACAAGTGCATTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-585s1c1
Sequence:CCGGGAGACTTGCTAAGAAATACTACTCGAGTAGTATTTCTTAGCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-830s1c1
Sequence:CCGGGCCAAGAATGTTCCATTAAATCTCGAGATTTAATGGAACATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145246
VALIDATED
FRA10AC1 MISSION shRNA shRNA Plasmid DNA
fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1306s21c1
Sequence:CCGGTGGAAGTTCATTAGTTCAATTCTCGAGAATTGAACTAATGAACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1329s21c1
Sequence:CCGGAGACTTTCCTGTCCTTTAAATCTCGAGATTTAAAGGACAGGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145246.3-504s21c1
Sequence:CCGGCAAGACAGACTTGGATGTTATCTCGAGATAACATCCAAGTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1414s21c1
Sequence:CCGGGATTCCATTGTTCCTACATTTCTCGAGAAATGTAGGAACAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-355s1c1
Sequence:CCGGGCAGAATTGCTGGATAGGGAACTCGAGTTCCCTATCCAGCAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145246.2-1021s1c1
Sequence:CCGGCTTAGAAACTCTGATGAGGAACTCGAGTTCCTCATCAGAGTTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-283s1c1
Sequence:CCGGGAAGATGACTTACTGCTCCAACTCGAGTTGGAGCAGTAAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-421s1c1
Sequence:CCGGCAAAGACATACAAAGTTCGTACTCGAGTACGAACTTTGTATGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-1007s1c1
Sequence:CCGGCTGAAGATTCTCTACTTAGAACTCGAGTTCTAAGTAGAGAATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-629s1c1
Sequence:CCGGGCATAGCAGATCTCAGTAAATCTCGAGATTTACTGAGATCTGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-798s1c1
Sequence:CCGGGAAGAGAAATGCACTTGTTAACTCGAGTTAACAAGTGCATTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-585s1c1
Sequence:CCGGGAGACTTGCTAAGAAATACTACTCGAGTAGTATTTCTTAGCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-830s1c1
Sequence:CCGGGCCAAGAATGTTCCATTAAATCTCGAGATTTAATGGAACATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145246
VALIDATED
FRA10AC1 MISSION shRNA Lentiviral Transduction Particles
fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1306s21c1
Sequence:CCGGTGGAAGTTCATTAGTTCAATTCTCGAGAATTGAACTAATGAACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1329s21c1
Sequence:CCGGAGACTTTCCTGTCCTTTAAATCTCGAGATTTAAAGGACAGGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145246.3-504s21c1
Sequence:CCGGCAAGACAGACTTGGATGTTATCTCGAGATAACATCCAAGTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145246.3-1414s21c1
Sequence:CCGGGATTCCATTGTTCCTACATTTCTCGAGAAATGTAGGAACAATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-355s1c1
Sequence:CCGGGCAGAATTGCTGGATAGGGAACTCGAGTTCCCTATCCAGCAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145246.2-1021s1c1
Sequence:CCGGCTTAGAAACTCTGATGAGGAACTCGAGTTCCTCATCAGAGTTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-283s1c1
Sequence:CCGGGAAGATGACTTACTGCTCCAACTCGAGTTGGAGCAGTAAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145246.2-421s1c1
Sequence:CCGGCAAAGACATACAAAGTTCGTACTCGAGTACGAACTTTGTATGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-1007s1c1
Sequence:CCGGCTGAAGATTCTCTACTTAGAACTCGAGTTCTAAGTAGAGAATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-629s1c1
Sequence:CCGGGCATAGCAGATCTCAGTAAATCTCGAGATTTACTGAGATCTGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-798s1c1
Sequence:CCGGGAAGAGAAATGCACTTGTTAACTCGAGTTAACAAGTGCATTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-585s1c1
Sequence:CCGGGAGACTTGCTAAGAAATACTACTCGAGTAGTATTTCTTAGCAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145246.2-830s1c1
Sequence:CCGGGCCAAGAATGTTCCATTAAATCTCGAGATTTAATGGAACATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081075
VALIDATED
FRA10AC1 MISSION shRNA Bacterial Glycerol Stock
fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-608s21c1
Sequence:CCGGCTGATCTCAGTAGATACAAAGCTCGAGCTTTGTATCTACTGAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-1120s21c1
Sequence:CCGGACTGGGAGAGAGAATCTTATTCTCGAGAATAAGATTCTCTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-299s21c1
Sequence:CCGGATGGAAAGGTGGCCCATAAACCTCGAGGTTTATGGGCCACCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-638s21c1
Sequence:CCGGTTGGATTTAGGTGGCGAATAGCTCGAGCTATTCGCCACCTAAATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081075
VALIDATED
FRA10AC1 MISSION shRNA shRNA Plasmid DNA
fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-608s21c1
Sequence:CCGGCTGATCTCAGTAGATACAAAGCTCGAGCTTTGTATCTACTGAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-1120s21c1
Sequence:CCGGACTGGGAGAGAGAATCTTATTCTCGAGAATAAGATTCTCTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-299s21c1
Sequence:CCGGATGGAAAGGTGGCCCATAAACCTCGAGGTTTATGGGCCACCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-638s21c1
Sequence:CCGGTTGGATTTAGGTGGCGAATAGCTCGAGCTATTCGCCACCTAAATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081075
VALIDATED
FRA10AC1 MISSION shRNA Lentiviral Transduction Particles
fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-608s21c1
Sequence:CCGGCTGATCTCAGTAGATACAAAGCTCGAGCTTTGTATCTACTGAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-1120s21c1
Sequence:CCGGACTGGGAGAGAGAATCTTATTCTCGAGAATAAGATTCTCTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-299s21c1
Sequence:CCGGATGGAAAGGTGGCCCATAAACCTCGAGGTTTATGGGCCACCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081075.1-638s21c1
Sequence:CCGGTTGGATTTAGGTGGCGAATAGCTCGAGCTATTCGCCACCTAAATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks