EMAIL THIS PAGE TO A FRIEND

FRAS1

Fraser syndrome 1

227 Gene Product Result for
Gene ID:
Human(80144) Summary: This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(231470) Fraser syndrome 1 homolog (human)
Rat(289486) Fraser syndrome 1
Zebrafish(563428) Fraser syndrome 1
cow(537989) Fraser syndrome 1
Horse(100051496) Fraser syndrome 1
dog(478446) Fraser syndrome 1
chicken(422506) Fraser syndrome 1
naked mole-rat(101706986) Fraser syndrome 1
domestic guinea pig(100721014) Fraser syndrome 1
sheep(101107282) Fraser syndrome 1
Domestic Rabbit(100358450) Fraser syndrome 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020875 Rosetta Predictions human pricing
NM_025074 Rosetta Predictions human pricing
NM_032863 Rosetta Predictions human pricing
NM_206841 Rosetta Predictions human pricing
XM_001062222 Rosetta Predictions rat pricing
XM_001062280 Rosetta Predictions rat pricing
XM_214004 Rosetta Predictions rat pricing
NM_175473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214548 predicted 564
2 SASI_Hs01_00214549 predicted 199
3 SASI_Hs01_00214550 predicted 515
4 SASI_Hs01_00214551 predicted 1025
5 SASI_Hs01_00214552 predicted 1105
6 SASI_Hs01_00214553 predicted 1053
7 SASI_Hs01_00214554 predicted 943
8 SASI_Hs01_00214555 predicted 1118
9 SASI_Hs01_00214556 predicted 342
10 SASI_Hs01_00214557 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357741 predicted 7338
2 SASI_Hs02_00357742 predicted 8047
3 SASI_Hs02_00357743 predicted 11459
4 SASI_Hs02_00357744 predicted 11114
5 SASI_Hs02_00357745 predicted 9714
6 SASI_Hs02_00357746 predicted 11177
7 SASI_Hs01_00076749 predicted 1521
8 SASI_Hs02_00357747 predicted 8330
9 SASI_Hs02_00357748 predicted 7225
10 SASI_Hs02_00357749 predicted 7720
11 SASI_Hs01_00076742 predicted 562
12 SASI_Hs01_00076743 predicted 199
13 SASI_Hs01_00076744 predicted 515
14 SASI_Hs01_00076745 predicted 1022
15 SASI_Hs01_00076746 predicted 1099
16 SASI_Hs01_00076747 predicted 1060
17 SASI_Hs01_00076748 predicted 944
18 SASI_Hs01_00076750 predicted 342
19 SASI_Hs01_00076751 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139154 predicted 562
2 SASI_Hs01_00139155 predicted 199
3 SASI_Hs01_00139156 predicted 506
4 SASI_Hs01_00139157 predicted 1025
5 SASI_Hs01_00139158 predicted 1107
6 SASI_Hs01_00139159 predicted 1057
7 SASI_Hs01_00139160 predicted 232
8 SASI_Hs01_00139161 predicted 946
9 SASI_Hs01_00139162 predicted 1093
10 SASI_Hs01_00139163 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031858 predicted 562
2 SASI_Hs01_00031859 predicted 202
3 SASI_Hs01_00031860 predicted 515
4 SASI_Hs01_00031861 predicted 1028
5 SASI_Hs01_00031862 predicted 1103
6 SASI_Hs01_00031863 predicted 1050
7 SASI_Hs01_00031864 predicted 943
8 SASI_Hs01_00031865 predicted 1120
9 SASI_Hs01_00031866 predicted 350
10 SASI_Hs01_00031867 predicted 1807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302728 predicted 4991
2 SASI_Rn02_00302729 predicted 7629
3 SASI_Rn02_00302730 predicted 5648
4 SASI_Rn02_00302731 predicted 10649
5 SASI_Rn02_00302732 predicted 5011
6 SASI_Rn02_00302733 predicted 4427
7 SASI_Rn02_00302734 predicted 1995
8 SASI_Rn02_00302735 predicted 6132
9 SASI_Rn02_00302736 predicted 7889
10 SASI_Rn02_00302737 predicted 6624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302926 predicted 5048
2 SASI_Rn02_00302927 predicted 7690
3 SASI_Rn02_00302928 predicted 5703
4 SASI_Rn02_00302929 predicted 10703
5 SASI_Rn02_00302930 predicted 5062
6 SASI_Rn02_00302931 predicted 4478
7 SASI_Rn02_00302932 predicted 1992
8 SASI_Rn02_00302933 predicted 6182
9 SASI_Rn02_00302934 predicted 7946
10 SASI_Rn02_00302935 predicted 6678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375076 predicted 5102
2 SASI_Rn02_00375077 predicted 7737
3 SASI_Rn02_00375078 predicted 7552
4 SASI_Rn02_00375079 predicted 11610
5 SASI_Rn02_00375080 predicted 10785
6 SASI_Rn02_00375081 predicted 5118
7 SASI_Rn02_00375082 predicted 4536
8 SASI_Rn02_00375083 predicted 2117
9 SASI_Rn02_00375084 predicted 8000
10 SASI_Rn02_00375085 predicted 6735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128458 predicted 6873
2 SASI_Mm01_00128459 predicted 7968
3 SASI_Mm01_00128460 predicted 7262
4 SASI_Mm01_00128461 predicted 1411
5 SASI_Mm01_00128462 predicted 8476
6 SASI_Mm01_00128463 predicted 5860
7 SASI_Mm02_00346386 predicted 7473
8 SASI_Mm01_00128464 predicted 6496
9 SASI_Mm01_00128465 predicted 9482
10 SASI_Mm01_00128466 predicted 11244
11 SASI_Mm01_00128467 predicted 6551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175473
FRAS1 MISSION shRNA Bacterial Glycerol Stock
Fraser syndrome 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175473.2-13960s1c1
Sequence:CCGGGCACACAACTTGCCTTTGTTTCTCGAGAAACAAAGGCAAGTTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-9438s1c1
Sequence:CCGGGCCCGGTATCACTGAACAATACTCGAGTATTGTTCAGTGATACCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-4675s1c1
Sequence:CCGGGCCTCTATTTATCAGTTCCATCTCGAGATGGAACTGATAAATAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-897s1c1
Sequence:CCGGGCTGGCGGAATTTGCAGTATTCTCGAGAATACTGCAAATTCCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-11822s1c1
Sequence:CCGGCGGTTGTGTATTCGCTCAATACTCGAGTATTGAGCGAATACACAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175473
FRAS1 MISSION shRNA shRNA Plasmid DNA
Fraser syndrome 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175473.2-13960s1c1
Sequence:CCGGGCACACAACTTGCCTTTGTTTCTCGAGAAACAAAGGCAAGTTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-9438s1c1
Sequence:CCGGGCCCGGTATCACTGAACAATACTCGAGTATTGTTCAGTGATACCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-4675s1c1
Sequence:CCGGGCCTCTATTTATCAGTTCCATCTCGAGATGGAACTGATAAATAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-897s1c1
Sequence:CCGGGCTGGCGGAATTTGCAGTATTCTCGAGAATACTGCAAATTCCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-11822s1c1
Sequence:CCGGCGGTTGTGTATTCGCTCAATACTCGAGTATTGAGCGAATACACAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175473
FRAS1 MISSION shRNA Lentiviral Transduction Particles
Fraser syndrome 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175473.2-13960s1c1
Sequence:CCGGGCACACAACTTGCCTTTGTTTCTCGAGAAACAAAGGCAAGTTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-9438s1c1
Sequence:CCGGGCCCGGTATCACTGAACAATACTCGAGTATTGTTCAGTGATACCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-4675s1c1
Sequence:CCGGGCCTCTATTTATCAGTTCCATCTCGAGATGGAACTGATAAATAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-897s1c1
Sequence:CCGGGCTGGCGGAATTTGCAGTATTCTCGAGAATACTGCAAATTCCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175473.2-11822s1c1
Sequence:CCGGCGGTTGTGTATTCGCTCAATACTCGAGTATTGAGCGAATACACAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020875
VALIDATED
FRAS1 MISSION shRNA Bacterial Glycerol Stock
Fraser syndrome 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020875.1-1535s1c1
Sequence:CCGGGCTTCTACCAAGATCGCCATTCTCGAGAATGGCGATCTTGGTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020875.1-2534s1c1
Sequence:CCGGGTCCTCAGTTTATGAGCTCTTCTCGAGAAGAGCTCATAAACTGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-68s1c1
Sequence:CCGGCGTTGGCGGAATTTGCAGTATCTCGAGATACTGCAAATTCCGCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-560s1c1
Sequence:CCGGGTGCCAAATGTCTGTGTAGAACTCGAGTTCTACACAGACATTTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-2370s1c1
Sequence:CCGGCCCTCACATCTCTCTTACCAACTCGAGTTGGTAAGAGAGATGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020875
VALIDATED
FRAS1 MISSION shRNA shRNA Plasmid DNA
Fraser syndrome 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020875.1-1535s1c1
Sequence:CCGGGCTTCTACCAAGATCGCCATTCTCGAGAATGGCGATCTTGGTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020875.1-2534s1c1
Sequence:CCGGGTCCTCAGTTTATGAGCTCTTCTCGAGAAGAGCTCATAAACTGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-68s1c1
Sequence:CCGGCGTTGGCGGAATTTGCAGTATCTCGAGATACTGCAAATTCCGCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-560s1c1
Sequence:CCGGGTGCCAAATGTCTGTGTAGAACTCGAGTTCTACACAGACATTTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-2370s1c1
Sequence:CCGGCCCTCACATCTCTCTTACCAACTCGAGTTGGTAAGAGAGATGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020875
VALIDATED
FRAS1 MISSION shRNA Lentiviral Transduction Particles
Fraser syndrome 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020875.1-1535s1c1
Sequence:CCGGGCTTCTACCAAGATCGCCATTCTCGAGAATGGCGATCTTGGTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020875.1-2534s1c1
Sequence:CCGGGTCCTCAGTTTATGAGCTCTTCTCGAGAAGAGCTCATAAACTGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-68s1c1
Sequence:CCGGCGTTGGCGGAATTTGCAGTATCTCGAGATACTGCAAATTCCGCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-560s1c1
Sequence:CCGGGTGCCAAATGTCTGTGTAGAACTCGAGTTCTACACAGACATTTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020875.1-2370s1c1
Sequence:CCGGCCCTCACATCTCTCTTACCAACTCGAGTTGGTAAGAGAGATGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025074
FRAS1 MISSION shRNA Bacterial Glycerol Stock
Fraser syndrome 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000435455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-6671s21c1
Sequence:CCGGCACACCTCACTTGGCTATAAACTCGAGTTTATAGCCAAGTGAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-9069s21c1
Sequence:CCGGGACACTCAGTATCCGGTAATTCTCGAGAATTACCGGATACTGAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-5023s21c1
Sequence:CCGGATTTCACGCAAGAGGATATTACTCGAGTAATATCCTCTTGCGTGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025074
FRAS1 MISSION shRNA shRNA Plasmid DNA
Fraser syndrome 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000435455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-6671s21c1
Sequence:CCGGCACACCTCACTTGGCTATAAACTCGAGTTTATAGCCAAGTGAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-9069s21c1
Sequence:CCGGGACACTCAGTATCCGGTAATTCTCGAGAATTACCGGATACTGAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-5023s21c1
Sequence:CCGGATTTCACGCAAGAGGATATTACTCGAGTAATATCCTCTTGCGTGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025074
FRAS1 MISSION shRNA Lentiviral Transduction Particles
Fraser syndrome 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000435455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-6671s21c1
Sequence:CCGGCACACCTCACTTGGCTATAAACTCGAGTTTATAGCCAAGTGAGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-9069s21c1
Sequence:CCGGGACACTCAGTATCCGGTAATTCTCGAGAATTACCGGATACTGAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025074.6-5023s21c1
Sequence:CCGGATTTCACGCAAGAGGATATTACTCGAGTAATATCCTCTTGCGTGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)