EMAIL THIS PAGE TO A FRIEND

FRAT1

frequently rearranged in advanced T-cell lymphomas

92 Gene Product Result for
UniProtKB ID: Q92837, Q5JTI1, Q8NE74, Q8TDW9
Gene ID:
Human(10023) Summary: The protein encoded by this gene belongs to the GSK-3-binding protein family. The protein inhibits GSK-3-mediated phosphorylation of beta-catenin and positively regulates the Wnt signaling pathway. It may function in tumor progression and in lymphomagenesis. [provided by RefSeq, Oct 2008]
Mouse(14296) frequently rearranged in advanced T cell lymphomas
naked mole-rat(101724371) frequently rearranged in advanced T-cell lymphomas
domestic cat(101087686) frequently rearranged in advanced T-cell lymphomas
dog(486819) frequently rearranged in advanced T-cell lymphomas
cow(505664) frequently rearranged in advanced T-cell lymphomas
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136801 MISSION® esiRNA esiRNA human FRAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005479 Rosetta Predictions human pricing
NM_008043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129296 predicted 1144
2 SASI_Hs01_00129297 predicted 1501
3 SASI_Hs01_00129298 predicted 1228
4 SASI_Hs02_00339659 predicted 860
5 SASI_Hs01_00129299 predicted 1269
6 SASI_Hs01_00129300 predicted 1414
7 SASI_Hs01_00129302 predicted 624
8 SASI_Hs01_00129303 predicted 1503
9 SASI_Hs01_00129304 predicted 1262
10 SASI_Hs01_00129305 predicted 1471
11 SASI_Hs01_00129301 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080725 predicted 689
2 SASI_Mm01_00080726 predicted 1063
3 SASI_Mm01_00080728 predicted 1332
4 SASI_Mm01_00080729 predicted 1070
5 SASI_Mm01_00080730 predicted 963
6 SASI_Mm01_00080731 predicted 1052
7 SASI_Mm01_00080732 predicted 870
8 SASI_Mm02_00313000 predicted 957
9 SASI_Mm01_00080733 predicted 2175
10 SASI_Mm01_00080734 predicted 1737
11 SASI_Mm01_00080727 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005479
FRAT1 MISSION shRNA Bacterial Glycerol Stock
frequently rearranged in advanced T-cell lymphomas
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005479.3-1274s21c1
Sequence:CCGGAGTCAGTAGGACTCCTTATTTCTCGAGAAATAAGGAGTCCTACTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005479.3-833s21c1
Sequence:CCGGAGGCCGTGCGAAGGCTTCATTCTCGAGAATGAAGCCTTCGCACGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005479.3-1474s21c1
Sequence:CCGGGAGGAGAACATGAGTAGATAACTCGAGTTATCTACTCATGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-862s1c1
Sequence:CCGGCTGCAGTTACGTGCAAAGCTTCTCGAGAAGCTTTGCACGTAACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-990s1c1
Sequence:CCGGGCTCAGAACTGGCGACGGCGTCTCGAGACGCCGTCGCCAGTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-742s1c1
Sequence:CCGGCGACGCGGGTCCCAACCAGAACTCGAGTTCTGGTTGGGACCCGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-260s1c1
Sequence:CCGGGCTTCCTCCTACTGCAGCAGTCTCGAGACTGCTGCAGTAGGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-810s1c1
Sequence:CCGGGCTCTCTGGAAACCTCATCAACTCGAGTTGATGAGGTTTCCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005479
FRAT1 MISSION shRNA shRNA Plasmid DNA
frequently rearranged in advanced T-cell lymphomas
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005479.3-1274s21c1
Sequence:CCGGAGTCAGTAGGACTCCTTATTTCTCGAGAAATAAGGAGTCCTACTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005479.3-833s21c1
Sequence:CCGGAGGCCGTGCGAAGGCTTCATTCTCGAGAATGAAGCCTTCGCACGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005479.3-1474s21c1
Sequence:CCGGGAGGAGAACATGAGTAGATAACTCGAGTTATCTACTCATGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-862s1c1
Sequence:CCGGCTGCAGTTACGTGCAAAGCTTCTCGAGAAGCTTTGCACGTAACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-990s1c1
Sequence:CCGGGCTCAGAACTGGCGACGGCGTCTCGAGACGCCGTCGCCAGTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-742s1c1
Sequence:CCGGCGACGCGGGTCCCAACCAGAACTCGAGTTCTGGTTGGGACCCGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-260s1c1
Sequence:CCGGGCTTCCTCCTACTGCAGCAGTCTCGAGACTGCTGCAGTAGGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-810s1c1
Sequence:CCGGGCTCTCTGGAAACCTCATCAACTCGAGTTGATGAGGTTTCCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005479
FRAT1 MISSION shRNA Lentiviral Transduction Particles
frequently rearranged in advanced T-cell lymphomas
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005479.3-1274s21c1
Sequence:CCGGAGTCAGTAGGACTCCTTATTTCTCGAGAAATAAGGAGTCCTACTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005479.3-833s21c1
Sequence:CCGGAGGCCGTGCGAAGGCTTCATTCTCGAGAATGAAGCCTTCGCACGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005479.3-1474s21c1
Sequence:CCGGGAGGAGAACATGAGTAGATAACTCGAGTTATCTACTCATGTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-862s1c1
Sequence:CCGGCTGCAGTTACGTGCAAAGCTTCTCGAGAAGCTTTGCACGTAACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-990s1c1
Sequence:CCGGGCTCAGAACTGGCGACGGCGTCTCGAGACGCCGTCGCCAGTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-742s1c1
Sequence:CCGGCGACGCGGGTCCCAACCAGAACTCGAGTTCTGGTTGGGACCCGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-260s1c1
Sequence:CCGGGCTTCCTCCTACTGCAGCAGTCTCGAGACTGCTGCAGTAGGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005479.2-810s1c1
Sequence:CCGGGCTCTCTGGAAACCTCATCAACTCGAGTTGATGAGGTTTCCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008043
FRAT1 MISSION shRNA Bacterial Glycerol Stock
frequently rearranged in advanced T-cell lymphomas
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008043.2-1065s1c1
Sequence:CCGGCCCAGGACTTAGGTTTGTTTACTCGAGTAAACAAACCTAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-703s1c1
Sequence:CCGGACAGCTACAGTTACACGCAAACTCGAGTTTGCGTGTAACTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-655s1c1
Sequence:CCGGGCTCTCGGGAAACCTCATCAACTCGAGTTGATGAGGTTTCCCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-695s1c1
Sequence:CCGGCATTCGCGACAGCTACAGTTACTCGAGTAACTGTAGCTGTCGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-702s1c1
Sequence:CCGGGACAGCTACAGTTACACGCAACTCGAGTTGCGTGTAACTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008043
FRAT1 MISSION shRNA shRNA Plasmid DNA
frequently rearranged in advanced T-cell lymphomas
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008043.2-1065s1c1
Sequence:CCGGCCCAGGACTTAGGTTTGTTTACTCGAGTAAACAAACCTAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-703s1c1
Sequence:CCGGACAGCTACAGTTACACGCAAACTCGAGTTTGCGTGTAACTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-655s1c1
Sequence:CCGGGCTCTCGGGAAACCTCATCAACTCGAGTTGATGAGGTTTCCCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-695s1c1
Sequence:CCGGCATTCGCGACAGCTACAGTTACTCGAGTAACTGTAGCTGTCGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-702s1c1
Sequence:CCGGGACAGCTACAGTTACACGCAACTCGAGTTGCGTGTAACTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008043
FRAT1 MISSION shRNA Lentiviral Transduction Particles
frequently rearranged in advanced T-cell lymphomas
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008043.2-1065s1c1
Sequence:CCGGCCCAGGACTTAGGTTTGTTTACTCGAGTAAACAAACCTAAGTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-703s1c1
Sequence:CCGGACAGCTACAGTTACACGCAAACTCGAGTTTGCGTGTAACTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-655s1c1
Sequence:CCGGGCTCTCGGGAAACCTCATCAACTCGAGTTGATGAGGTTTCCCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-695s1c1
Sequence:CCGGCATTCGCGACAGCTACAGTTACTCGAGTAACTGTAGCTGTCGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008043.2-702s1c1
Sequence:CCGGGACAGCTACAGTTACACGCAACTCGAGTTGCGTGTAACTGTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks