EMAIL THIS PAGE TO A FRIEND

FRAT2

frequently rearranged in advanced T-cell lymphomas 2

112 Gene Product Result for
UniProtKB ID: O75474, Q5JTI0, Q8WUL9, Q9BYG2
Gene ID:
Human(23401) Summary: The protein encoded by this intronless gene belongs to the GSK-3-binding protein family. Studies show that this protein plays a role as a positive regulator of the WNT signaling pathway. It may be upregulated in tumor progression. [provided by RefSeq, Jul 2008]
Mouse(212398) frequently rearranged in advanced T cell lymphomas 2
Rat(679110) frequently rearranged in advanced T-cell lymphomas 2
dog(100684222) frequently rearranged in advanced T-cell lymphomas 2
cow(539144) frequently rearranged in advanced T-cell lymphomas 2
domestic guinea pig(101789016) frequently rearranged in advanced T-cell lymphomas 2
sheep(101108269) frequently rearranged in advanced T-cell lymphomas 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012083 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012083 Rosetta Predictions human pricing
XM_001054746 Rosetta Predictions rat pricing
NM_177603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212306 predicted 1198
2 SASI_Hs01_00212307 predicted 1281
3 SASI_Hs01_00212308 predicted 1155
4 SASI_Hs01_00212309 predicted 1205
5 SASI_Hs02_00343566 predicted 1279
6 SASI_Hs01_00212310 predicted 1228
7 SASI_Hs01_00212311 predicted 880
8 SASI_Hs02_00343567 predicted 1094
9 SASI_Hs01_00212312 predicted 870
10 SASI_Hs01_00212313 predicted 1265
11 SASI_Hs01_00212314 predicted 1110
12 SASI_Hs01_00212315 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277009 predicted 365
2 SASI_Rn02_00277010 predicted 471
3 SASI_Rn02_00277011 predicted 433
4 SASI_Rn02_00277012 predicted 359
5 SASI_Rn02_00277013 predicted 716
6 SASI_Rn02_00277014 predicted 466
7 SASI_Rn02_00277015 predicted 539
8 SASI_Rn02_00277016 predicted 463
9 SASI_Rn02_00277017 predicted 721
10 SASI_Rn02_00277018 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027243 predicted 1254
2 SASI_Mm01_00027244 predicted 1013
3 SASI_Mm01_00027245 predicted 1156
4 SASI_Mm01_00027246 predicted 1260
5 SASI_Mm01_00027247 predicted 1200
6 SASI_Mm01_00027248 predicted 1322
7 SASI_Mm01_00027249 predicted 1365
8 SASI_Mm01_00027250 predicted 1115
9 SASI_Mm01_00027251 predicted 1259
10 SASI_Mm01_00027252 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177603
FRAT2 MISSION shRNA Bacterial Glycerol Stock
frequently rearranged in advanced T-cell lymphomas 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1336s1c1
Sequence:CCGGGCAGATTTATGTTGGTGGGTTCTCGAGAACCCACCAACATAAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1648s1c1
Sequence:CCGGGCGGTTTCTGTGCTTTGCTTTCTCGAGAAAGCAAAGCACAGAAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1015s1c1
Sequence:CCGGCGGGCTACATCCTCAAAGTTACTCGAGTAACTTTGAGGATGTAGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1373s1c1
Sequence:CCGGCCCTGCTTAATTTGTGATTATCTCGAGATAATCACAAATTAAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1235s21c1
Sequence:CCGGTAGTAGATATGATCTCGTTATCTCGAGATAACGAGATCATATCTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1092s21c1
Sequence:CCGGACCTGGGATCTACCGGTTGAACTCGAGTTCAACCGGTAGATCCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1013s21c1
Sequence:CCGGGGGCTACAGCCTCAAAGTTACCTCGAGGTAACTTTGAGGCTGTAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177603
FRAT2 MISSION shRNA shRNA Plasmid DNA
frequently rearranged in advanced T-cell lymphomas 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1336s1c1
Sequence:CCGGGCAGATTTATGTTGGTGGGTTCTCGAGAACCCACCAACATAAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1648s1c1
Sequence:CCGGGCGGTTTCTGTGCTTTGCTTTCTCGAGAAAGCAAAGCACAGAAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1015s1c1
Sequence:CCGGCGGGCTACATCCTCAAAGTTACTCGAGTAACTTTGAGGATGTAGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1373s1c1
Sequence:CCGGCCCTGCTTAATTTGTGATTATCTCGAGATAATCACAAATTAAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1235s21c1
Sequence:CCGGTAGTAGATATGATCTCGTTATCTCGAGATAACGAGATCATATCTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1092s21c1
Sequence:CCGGACCTGGGATCTACCGGTTGAACTCGAGTTCAACCGGTAGATCCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1013s21c1
Sequence:CCGGGGGCTACAGCCTCAAAGTTACCTCGAGGTAACTTTGAGGCTGTAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177603
FRAT2 MISSION shRNA Lentiviral Transduction Particles
frequently rearranged in advanced T-cell lymphomas 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1336s1c1
Sequence:CCGGGCAGATTTATGTTGGTGGGTTCTCGAGAACCCACCAACATAAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1648s1c1
Sequence:CCGGGCGGTTTCTGTGCTTTGCTTTCTCGAGAAAGCAAAGCACAGAAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1015s1c1
Sequence:CCGGCGGGCTACATCCTCAAAGTTACTCGAGTAACTTTGAGGATGTAGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191381    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177603.1-1373s1c1
Sequence:CCGGCCCTGCTTAATTTGTGATTATCTCGAGATAATCACAAATTAAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1235s21c1
Sequence:CCGGTAGTAGATATGATCTCGTTATCTCGAGATAACGAGATCATATCTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1092s21c1
Sequence:CCGGACCTGGGATCTACCGGTTGAACTCGAGTTCAACCGGTAGATCCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177603.3-1013s21c1
Sequence:CCGGGGGCTACAGCCTCAAAGTTACCTCGAGGTAACTTTGAGGCTGTAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012083
VALIDATED
FRAT2 MISSION shRNA Bacterial Glycerol Stock
frequently rearranged in advanced T-cell lymphomas 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012083.2-1797s1c1
Sequence:CCGGCCACCCTTTCTGGTGTCTATACTCGAGTATAGACACCAGAAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-781s1c1
Sequence:CCGGCGCAGCGGACCTGACCGCATTCTCGAGAATGCGGTCAGGTCCGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-567s1c1
Sequence:CCGGAGGATGGCTCAGGGACGCGGTCTCGAGACCGCGTCCCTGAGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-654s1c1
Sequence:CCGGGCATCGGCTCCTCCAGCAGCTCTCGAGAGCTGCTGGAGGAGCCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-878s21c1
Sequence:CCGGCAGCGTCCAGTTCCTACTAACCTCGAGGTTAGTAGGAACTGGACGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-1196s21c1
Sequence:CCGGGTAGGAATCGCGATGGCTTTACTCGAGTAAAGCCATCGCGATTCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-968s21c1
Sequence:CCGGATCTCAACCAGAGAAGTTACCCTCGAGGGTAACTTCTCTGGTTGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-1274s21c1
Sequence:CCGGCTTAGTAAGTGGTGCTACAATCTCGAGATTGTAGCACCACTTACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012083
VALIDATED
FRAT2 MISSION shRNA shRNA Plasmid DNA
frequently rearranged in advanced T-cell lymphomas 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012083.2-1797s1c1
Sequence:CCGGCCACCCTTTCTGGTGTCTATACTCGAGTATAGACACCAGAAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-781s1c1
Sequence:CCGGCGCAGCGGACCTGACCGCATTCTCGAGAATGCGGTCAGGTCCGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-567s1c1
Sequence:CCGGAGGATGGCTCAGGGACGCGGTCTCGAGACCGCGTCCCTGAGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-654s1c1
Sequence:CCGGGCATCGGCTCCTCCAGCAGCTCTCGAGAGCTGCTGGAGGAGCCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-878s21c1
Sequence:CCGGCAGCGTCCAGTTCCTACTAACCTCGAGGTTAGTAGGAACTGGACGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-1196s21c1
Sequence:CCGGGTAGGAATCGCGATGGCTTTACTCGAGTAAAGCCATCGCGATTCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-968s21c1
Sequence:CCGGATCTCAACCAGAGAAGTTACCCTCGAGGGTAACTTCTCTGGTTGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-1274s21c1
Sequence:CCGGCTTAGTAAGTGGTGCTACAATCTCGAGATTGTAGCACCACTTACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012083
VALIDATED
FRAT2 MISSION shRNA Lentiviral Transduction Particles
frequently rearranged in advanced T-cell lymphomas 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012083.2-1797s1c1
Sequence:CCGGCCACCCTTTCTGGTGTCTATACTCGAGTATAGACACCAGAAAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-781s1c1
Sequence:CCGGCGCAGCGGACCTGACCGCATTCTCGAGAATGCGGTCAGGTCCGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-567s1c1
Sequence:CCGGAGGATGGCTCAGGGACGCGGTCTCGAGACCGCGTCCCTGAGCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012083.2-654s1c1
Sequence:CCGGGCATCGGCTCCTCCAGCAGCTCTCGAGAGCTGCTGGAGGAGCCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-878s21c1
Sequence:CCGGCAGCGTCCAGTTCCTACTAACCTCGAGGTTAGTAGGAACTGGACGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-1196s21c1
Sequence:CCGGGTAGGAATCGCGATGGCTTTACTCGAGTAAAGCCATCGCGATTCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-968s21c1
Sequence:CCGGATCTCAACCAGAGAAGTTACCCTCGAGGGTAACTTCTCTGGTTGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012083.2-1274s21c1
Sequence:CCGGCTTAGTAAGTGGTGCTACAATCTCGAGATTGTAGCACCACTTACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)