EMAIL THIS PAGE TO A FRIEND

FREM1

FRAS1 related extracellular matrix 1

78 Gene Product Result for
Synonyms: BNAR C9orf143 C9orf145 C9orf154 MOTA TILRR TRIGNO2
Gene ID:
Human(158326) Summary: This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
Mouse(329872) Fras1 related extracellular matrix protein 1
Rat(298185) Fras1 related extracellular matrix 1
chicken(427355) FRAS1 related extracellular matrix 1
dog(481547) FRAS1 related extracellular matrix 1
domestic cat(101096177) FRAS1 related extracellular matrix 1
cow(508018) FRAS1 related extracellular matrix 1
Horse(100062297) FRAS1 related extracellular matrix 1
sheep(101121399) FRAS1 related extracellular matrix 1
Domestic Rabbit(100340366) FRAS1 related extracellular matrix 1
domestic guinea pig(100721071) FRAS1 related extracellular matrix 1
naked mole-rat(101713531) FRAS1 related extracellular matrix 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104121 Anti-FREM1 (197-210) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB3500516 Anti-FREM1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB2900894 Anti-FREM1 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144966 Rosetta Predictions human pricing
XM_001070129 Rosetta Predictions rat pricing
XM_233112 Rosetta Predictions rat pricing
NM_177863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020153 predicted 3227
2 SASI_Hs02_00364752 predicted 5829
3 SASI_Hs02_00364753 predicted 3331
4 SASI_Hs01_00020156 predicted 859
5 SASI_Hs01_00020157 predicted 6020
6 SASI_Hs02_00364754 predicted 4797
7 SASI_Hs02_00364755 predicted 4901
8 SASI_Hs01_00020158 predicted 3031
9 SASI_Hs02_00364756 predicted 6087
10 SASI_Hs02_00364757 predicted 4903
11 SASI_Hs01_00020152 predicted 4704
12 SASI_Hs01_00020154 predicted 3234
13 SASI_Hs01_00020155 predicted 1951
14 SASI_Hs01_00020159 predicted 4513
15 SASI_Hs01_00020160 predicted 1795
16 SASI_Hs01_00020161 predicted 4677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330534 predicted 5271
2 SASI_Rn02_00330535 predicted 5849
3 SASI_Rn02_00330536 predicted 3323
4 SASI_Rn02_00330537 predicted 5347
5 SASI_Rn02_00330538 predicted 3359
6 SASI_Rn02_00330539 predicted 1933
7 SASI_Rn02_00330540 predicted 5466
8 SASI_Rn02_00330541 predicted 4383
9 SASI_Rn02_00330542 predicted 5093
10 SASI_Rn02_00330543 predicted 5469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387430 predicted 3127
2 SASI_Rn02_00387431 predicted 3319
3 SASI_Rn02_00387432 predicted 306
4 SASI_Rn02_00387433 predicted 3867
5 SASI_Rn02_00387434 predicted 3782
6 SASI_Rn02_00387435 predicted 3365
7 SASI_Rn02_00387436 predicted 327
8 SASI_Rn02_00387437 predicted 1933
9 SASI_Rn02_00387438 predicted 3500
10 SASI_Rn02_00387439 predicted 2649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348342 predicted 5721
2 SASI_Mm02_00348343 predicted 6170
3 SASI_Mm01_00187148 predicted 588
4 SASI_Mm01_00187149 predicted 5452
5 SASI_Mm01_00187150 predicted 5740
6 SASI_Mm01_00187151 predicted 750
7 SASI_Mm01_00187152 predicted 5627
8 SASI_Mm01_00187153 predicted 4453
9 SASI_Mm01_00187154 predicted 5403
10 SASI_Mm01_00187155 predicted 2524
11 SASI_Mm01_00187156 predicted 5705
12 SASI_Mm01_00187157 predicted 3593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144966
FREM1 MISSION shRNA Bacterial Glycerol Stock
FRAS1 related extracellular matrix 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-4451s21c1
Sequence:CCGGTATGGGTGAAACTCGTATTATCTCGAGATAATACGAGTTTCACCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-3110s21c1
Sequence:CCGGGGGCGATCTCCATACCTTAAACTCGAGTTTAAGGTATGGAGATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-2070s21c1
Sequence:CCGGTTCGTGGTCTTCCGGATATTTCTCGAGAAATATCCGGAAGACCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-620s1c1
Sequence:CCGGCCATCTAAACTGATTCAGTTTCTCGAGAAACTGAATCAGTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-177s1c1
Sequence:CCGGGCTACGGGATTTACATCACTTCTCGAGAAGTGATGTAAATCCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-563s1c1
Sequence:CCGGGTGGGTATAAAGGTCAACCAACTCGAGTTGGTTGACCTTTATACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-298s1c1
Sequence:CCGGAGGTGAATTTATCCATGAGAACTCGAGTTCTCATGGATAAATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-484s1c1
Sequence:CCGGCGAATATGAAGTCTGTGAGAACTCGAGTTCTCACAGACTTCATATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144966
FREM1 MISSION shRNA shRNA Plasmid DNA
FRAS1 related extracellular matrix 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-4451s21c1
Sequence:CCGGTATGGGTGAAACTCGTATTATCTCGAGATAATACGAGTTTCACCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-3110s21c1
Sequence:CCGGGGGCGATCTCCATACCTTAAACTCGAGTTTAAGGTATGGAGATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-2070s21c1
Sequence:CCGGTTCGTGGTCTTCCGGATATTTCTCGAGAAATATCCGGAAGACCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-620s1c1
Sequence:CCGGCCATCTAAACTGATTCAGTTTCTCGAGAAACTGAATCAGTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-177s1c1
Sequence:CCGGGCTACGGGATTTACATCACTTCTCGAGAAGTGATGTAAATCCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-563s1c1
Sequence:CCGGGTGGGTATAAAGGTCAACCAACTCGAGTTGGTTGACCTTTATACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-298s1c1
Sequence:CCGGAGGTGAATTTATCCATGAGAACTCGAGTTCTCATGGATAAATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-484s1c1
Sequence:CCGGCGAATATGAAGTCTGTGAGAACTCGAGTTCTCACAGACTTCATATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144966
FREM1 MISSION shRNA Lentiviral Transduction Particles
FRAS1 related extracellular matrix 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-4451s21c1
Sequence:CCGGTATGGGTGAAACTCGTATTATCTCGAGATAATACGAGTTTCACCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-3110s21c1
Sequence:CCGGGGGCGATCTCCATACCTTAAACTCGAGTTTAAGGTATGGAGATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144966.4-2070s21c1
Sequence:CCGGTTCGTGGTCTTCCGGATATTTCTCGAGAAATATCCGGAAGACCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-620s1c1
Sequence:CCGGCCATCTAAACTGATTCAGTTTCTCGAGAAACTGAATCAGTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-177s1c1
Sequence:CCGGGCTACGGGATTTACATCACTTCTCGAGAAGTGATGTAAATCCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-563s1c1
Sequence:CCGGGTGGGTATAAAGGTCAACCAACTCGAGTTGGTTGACCTTTATACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-298s1c1
Sequence:CCGGAGGTGAATTTATCCATGAGAACTCGAGTTCTCATGGATAAATTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144966.1-484s1c1
Sequence:CCGGCGAATATGAAGTCTGTGAGAACTCGAGTTCTCACAGACTTCATATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177863
FREM1 MISSION shRNA Bacterial Glycerol Stock
FRAS1 related extracellular matrix 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177863.3-8024s1c1
Sequence:CCGGGCCAAATATAACCTGTCATATCTCGAGATATGACAGGTTATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-6372s1c1
Sequence:CCGGGCACCCACAGATTGTATCAATCTCGAGATTGATACAATCTGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-4235s1c1
Sequence:CCGGCCCAGAGAGAAGATTCACTATCTCGAGATAGTGAATCTTCTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-1808s1c1
Sequence:CCGGCCTATCAACATCTTGCCTAAACTCGAGTTTAGGCAAGATGTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-2269s1c1
Sequence:CCGGGCACCTACATTTCCTAGACATCTCGAGATGTCTAGGAAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177863
FREM1 MISSION shRNA shRNA Plasmid DNA
FRAS1 related extracellular matrix 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177863.3-8024s1c1
Sequence:CCGGGCCAAATATAACCTGTCATATCTCGAGATATGACAGGTTATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-6372s1c1
Sequence:CCGGGCACCCACAGATTGTATCAATCTCGAGATTGATACAATCTGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-4235s1c1
Sequence:CCGGCCCAGAGAGAAGATTCACTATCTCGAGATAGTGAATCTTCTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-1808s1c1
Sequence:CCGGCCTATCAACATCTTGCCTAAACTCGAGTTTAGGCAAGATGTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-2269s1c1
Sequence:CCGGGCACCTACATTTCCTAGACATCTCGAGATGTCTAGGAAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177863
FREM1 MISSION shRNA Lentiviral Transduction Particles
FRAS1 related extracellular matrix 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177863.3-8024s1c1
Sequence:CCGGGCCAAATATAACCTGTCATATCTCGAGATATGACAGGTTATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-6372s1c1
Sequence:CCGGGCACCCACAGATTGTATCAATCTCGAGATTGATACAATCTGTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-4235s1c1
Sequence:CCGGCCCAGAGAGAAGATTCACTATCTCGAGATAGTGAATCTTCTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-1808s1c1
Sequence:CCGGCCTATCAACATCTTGCCTAAACTCGAGTTTAGGCAAGATGTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177863.3-2269s1c1
Sequence:CCGGGCACCTACATTTCCTAGACATCTCGAGATGTCTAGGAAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks