EMAIL THIS PAGE TO A FRIEND

FREM2

FRAS1 related extracellular matrix protein 2

177 Gene Product Result for
Gene ID:
Human(341640) Summary: This gene encodes a membrane protein that belongs to the FRAS1 family. This extracellular matrix protein is thought to be required for maintaining the integrity of the skin epithelium and the differentiated state of renal epithelia. The protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions during morphogenetic processes. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Jul 2008]
Mouse(242022) Fras1 related extracellular matrix protein 2
Rat(310418) Fras1 related extracellular matrix protein 2
chicken(418893) FRAS1 related extracellular matrix protein 2
cow(527601) FRAS1 related extracellular matrix protein 2
domestic cat(101087292) FRAS1 related extracellular matrix protein 2
dog(486002) FRAS1 related extracellular matrix protein 2
naked mole-rat(101713720) FRAS1 related extracellular matrix protein 2
domestic guinea pig(100728460) FRAS1 related extracellular matrix protein 2
sheep(101101900) FRAS1 related extracellular matrix protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207361 Rosetta Predictions human pricing
XM_929884 Rosetta Predictions human pricing
XM_001057556 Rosetta Predictions rat pricing
XM_227142 Rosetta Predictions rat pricing
NM_172862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373926 predicted 4024
2 SASI_Hs01_00017375 predicted 3785
3 SASI_Hs01_00017376 predicted 8207
4 SASI_Hs01_00017377 predicted 8226
5 SASI_Hs01_00017378 predicted 2575
6 SASI_Hs01_00017379 predicted 3162
7 SASI_Hs02_00373927 predicted 6695
8 SASI_Hs01_00017380 predicted 4860
9 SASI_Hs01_00017381 predicted 3430
10 SASI_Hs01_00017382 predicted 8666
11 SASI_Hs01_00017374 predicted 4054
12 SASI_Hs01_00017383 predicted 8950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273404 predicted 4356
2 SASI_Hs01_00273405 predicted 3792
3 SASI_Hs01_00273406 predicted 8200
4 SASI_Hs01_00273407 predicted 8228
5 SASI_Hs01_00273408 predicted 2575
6 SASI_Hs01_00273409 predicted 3163
7 SASI_Hs01_00273410 predicted 4857
8 SASI_Hs01_00273411 predicted 3437
9 SASI_Hs01_00273412 predicted 8661
10 SASI_Hs01_00273413 predicted 9261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286795 predicted 8895
2 SASI_Rn02_00286796 predicted 7944
3 SASI_Rn02_00286797 predicted 5512
4 SASI_Rn02_00286798 predicted 3299
5 SASI_Rn02_00286799 predicted 4322
6 SASI_Rn02_00286800 predicted 4166
7 SASI_Rn02_00286801 predicted 5445
8 SASI_Rn02_00286802 predicted 5482
9 SASI_Rn02_00286803 predicted 7555
10 SASI_Rn02_00286804 predicted 8828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384117 predicted 8892
2 SASI_Rn02_00384118 predicted 7935
3 SASI_Rn02_00384119 predicted 3296
4 SASI_Rn02_00384120 predicted 4319
5 SASI_Rn02_00384121 predicted 4173
6 SASI_Rn02_00384122 predicted 9560
7 SASI_Rn02_00384123 predicted 7551
8 SASI_Rn02_00384124 predicted 8832
9 SASI_Rn02_00384125 predicted 8177
10 SASI_Rn02_00384126 predicted 7839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149871 predicted 6668
2 SASI_Mm01_00149872 predicted 4246
3 SASI_Mm01_00149873 predicted 8967
4 SASI_Mm01_00149875 predicted 5563
5 SASI_Mm01_00149876 predicted 606
6 SASI_Mm01_00149877 predicted 4610
7 SASI_Mm01_00149878 predicted 8152
8 SASI_Mm01_00149879 predicted 3143
9 SASI_Mm01_00149880 predicted 3089
10 SASI_Mm02_00344822 predicted 5595
11 SASI_Mm01_00149874 predicted 3026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172862
FREM2 MISSION shRNA Bacterial Glycerol Stock
FRAS1 related extracellular matrix protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172862.1-3101s1c1
Sequence:CCGGCGGAAATGACAAGTTGTCTAACTCGAGTTAGACAACTTGTCATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-887s1c1
Sequence:CCGGCTGCTGGACTACAATGAAGTACTCGAGTACTTCATTGTAGTCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-889s1c1
Sequence:CCGGGCTGGACTACAATGAAGTAAACTCGAGTTTACTTCATTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-275s1c1
Sequence:CCGGTCCTTGCTGATATACGATGATCTCGAGATCATCGTATATCAGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-1656s1c1
Sequence:CCGGCCTTTGACCTTGACATTCGATCTCGAGATCGAATGTCAAGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172862
FREM2 MISSION shRNA shRNA Plasmid DNA
FRAS1 related extracellular matrix protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172862.1-3101s1c1
Sequence:CCGGCGGAAATGACAAGTTGTCTAACTCGAGTTAGACAACTTGTCATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-887s1c1
Sequence:CCGGCTGCTGGACTACAATGAAGTACTCGAGTACTTCATTGTAGTCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-889s1c1
Sequence:CCGGGCTGGACTACAATGAAGTAAACTCGAGTTTACTTCATTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-275s1c1
Sequence:CCGGTCCTTGCTGATATACGATGATCTCGAGATCATCGTATATCAGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-1656s1c1
Sequence:CCGGCCTTTGACCTTGACATTCGATCTCGAGATCGAATGTCAAGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172862
FREM2 MISSION shRNA Lentiviral Transduction Particles
FRAS1 related extracellular matrix protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172862.1-3101s1c1
Sequence:CCGGCGGAAATGACAAGTTGTCTAACTCGAGTTAGACAACTTGTCATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-887s1c1
Sequence:CCGGCTGCTGGACTACAATGAAGTACTCGAGTACTTCATTGTAGTCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-889s1c1
Sequence:CCGGGCTGGACTACAATGAAGTAAACTCGAGTTTACTTCATTGTAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-275s1c1
Sequence:CCGGTCCTTGCTGATATACGATGATCTCGAGATCATCGTATATCAGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172862.1-1656s1c1
Sequence:CCGGCCTTTGACCTTGACATTCGATCTCGAGATCGAATGTCAAGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207361
VALIDATED
FREM2 MISSION shRNA Bacterial Glycerol Stock
FRAS1 related extracellular matrix protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-2841s1c1
Sequence:CCGGGTTTAGCTTGAACACCCAAATCTCGAGATTTGGGTGTTCAAGCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207361.2-3055s1c1
Sequence:CCGGCCCAAGTATAGTCCAATGAATCTCGAGATTCATTGGACTATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207361.2-6695s1c1
Sequence:CCGGGCAGCTCTTTATTTGGACTAACTCGAGTTAGTCCAAATAAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_207361.2-3096s1c1
Sequence:CCGGCGACTCTCCTTCACTCTTATACTCGAGTATAAGAGTGAAGGAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_207361.2-1318s1c1
Sequence:CCGGGCAGAGATGCAGTTGACGAAACTCGAGTTTCGTCAACTGCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207361.2-2789s1c1
Sequence:CCGGCCTTTGACCTTGACATCCGATCTCGAGATCGGATGTCAAGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-2243s1c1
Sequence:CCGGGAACAGATGGACAGGTCCTAACTCGAGTTAGGACCTGTCCATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-1395s1c1
Sequence:CCGGCCCTCAAATTGTATCCCTGTTCTCGAGAACAGGGATACAATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207361.2-5300s1c1
Sequence:CCGGCCCTTTGACTTCTAGCCATAACTCGAGTTATGGCTAGAAGTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207361
VALIDATED
FREM2 MISSION shRNA shRNA Plasmid DNA
FRAS1 related extracellular matrix protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-2841s1c1
Sequence:CCGGGTTTAGCTTGAACACCCAAATCTCGAGATTTGGGTGTTCAAGCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207361.2-3055s1c1
Sequence:CCGGCCCAAGTATAGTCCAATGAATCTCGAGATTCATTGGACTATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207361.2-6695s1c1
Sequence:CCGGGCAGCTCTTTATTTGGACTAACTCGAGTTAGTCCAAATAAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_207361.2-3096s1c1
Sequence:CCGGCGACTCTCCTTCACTCTTATACTCGAGTATAAGAGTGAAGGAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_207361.2-1318s1c1
Sequence:CCGGGCAGAGATGCAGTTGACGAAACTCGAGTTTCGTCAACTGCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207361.2-2789s1c1
Sequence:CCGGCCTTTGACCTTGACATCCGATCTCGAGATCGGATGTCAAGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-2243s1c1
Sequence:CCGGGAACAGATGGACAGGTCCTAACTCGAGTTAGGACCTGTCCATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-1395s1c1
Sequence:CCGGCCCTCAAATTGTATCCCTGTTCTCGAGAACAGGGATACAATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207361.2-5300s1c1
Sequence:CCGGCCCTTTGACTTCTAGCCATAACTCGAGTTATGGCTAGAAGTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207361
VALIDATED
FREM2 MISSION shRNA Lentiviral Transduction Particles
FRAS1 related extracellular matrix protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-2841s1c1
Sequence:CCGGGTTTAGCTTGAACACCCAAATCTCGAGATTTGGGTGTTCAAGCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207361.2-3055s1c1
Sequence:CCGGCCCAAGTATAGTCCAATGAATCTCGAGATTCATTGGACTATACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207361.2-6695s1c1
Sequence:CCGGGCAGCTCTTTATTTGGACTAACTCGAGTTAGTCCAAATAAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_207361.2-3096s1c1
Sequence:CCGGCGACTCTCCTTCACTCTTATACTCGAGTATAAGAGTGAAGGAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_207361.2-1318s1c1
Sequence:CCGGGCAGAGATGCAGTTGACGAAACTCGAGTTTCGTCAACTGCATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207361.2-2789s1c1
Sequence:CCGGCCTTTGACCTTGACATCCGATCTCGAGATCGGATGTCAAGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-2243s1c1
Sequence:CCGGGAACAGATGGACAGGTCCTAACTCGAGTTAGGACCTGTCCATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_207361.2-1395s1c1
Sequence:CCGGCCCTCAAATTGTATCCCTGTTCTCGAGAACAGGGATACAATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207361.2-5300s1c1
Sequence:CCGGCCCTTTGACTTCTAGCCATAACTCGAGTTATGGCTAGAAGTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks